Oxylobium arborescens

R.Br. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Oxylobium

At a glance

Occurrence records1 795

Data sources9

Biological traits32

DNA specimens1

eDNA detections1

Sources9 archives

Databases and archives Oxylobium arborescens's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 795 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources32 traits

Occurrence & distributionGBIF1 795 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 16

01Narrative

Oxylobium arborescens, commonly known as the tall shaggy-pea, is a species of flowering shrub to small tree in the family Fabaceae and is endemic to south-eastern Australia. It has elliptic dark green leaves and yellow pea flowers.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAusTraitsTRYWCVPGIFT

Size & morphology13

Fruit length8 mm

Leaf length50 mm

Leaf mass per area144 g/m2

Leaf size192 mm²

⚠ sources differ — TRY: 192 mm² · AusTraits: 371 mm²

Leaf width8 mm

Petiole length0.4 cm

Plant height6 m

⚠ sources differ — AusTraits: 6 m · TRY: 3.2 m

Plant height max6 m

Seed length2.19 mm

Seed mass3.39 mg

Seed mass max4.06 mg

Seed mass min2.72 mg

Seed width0.942 mm

Life cycle & reproduction7

Dispersal typeself

Flowering timeyynnnnnnyyyy

Life spanperennial

Pollination syndromeinsect

Reproductive maturity4 years

Resprouting capacityfire_killed

Sex typehermaphrodite+monoecious

Habitat & environment7

Climatesubtropical

Fruit fleshinessdry

Fruit typelegume

Growth formshrub

Leaf compoundnesssimple

Leaf shapelinear narrowly_elliptical narrowly_oblong

Woodinesswoody

Physiology & chemistry4

Nitrogen fixingnitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)6.95 mm²/mg

Wood density700 mg/cm³

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Oxylobium arborescens has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences4

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAY015217.1 ↗566 bp

ACGT

CCGAGGGCAGGCTCGGGGGTGCTAGACACCTCAGACCTCTCTCGTGCCGGGAGGTGCTCTCCCCGTGAGGGTGCCATCCTAGCTGAACAC …

Oxylobium arborescens internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Oxylobium arborescens carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 161×CCDB · book-ipcn75-78

CCDB · book-ipcn75-78 — Sands 1975

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 795 records

Wild obs. + sensor1 259

Museum / vouchered531

Cultivated / captive4

Other1

Origin

Native63

Range

Area of Occupancy AOO3 616 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 929≤1 km 174≤10 km 119>10 km 9

1 231 georeferenced · 28 without coordinates

Open the mapobservation + sensor1 259

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy52% within 1 km

≤100 m 55≤1 km 193≤10 km 192>10 km 33

473 georeferenced · 58 without coordinates

Open the institutions mapphysical evidence531

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 3

3 georeferenced · 1 without coordinates

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo Entomologico de Leonlocation not on record	176
Canberra, AU	94
Hobart, AU	85
Mount Annan, AU	63
Brisbane, AU	36
Armidale, AU	25
Adelaide, AU	15
QVMAGlocation not on record	8
Wollongong, AU	7
Parkville, AU	6
Kew, GB	4
La Trobe Universitylocation not on record	3
NSW Dept of Planning, Industry and Environmentlocation not on record	2
Auckland, NZ	2
EL PASO, US	1
Christchurch, NZ	1
Batemans Bay, AU	1
Cambridge University Herbariumlocation not on record	1

18 institutions · 530 of 531 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Oxylobium arborescens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Oxylobium arborescens

At a glance

Sources9 archives

Size & morphology13

Life cycle & reproduction7

Habitat & environment7

Physiology & chemistry4

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 795 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions13 of 18 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type1 795 records