Oxalis oregana

Nutt. ex Torr. & A.Gray · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Oxalidales/Oxalidaceae/Oxalis

At a glance

Occurrence records2 683

Data sources7

Biological traits16

DNA specimens12

eDNA detections8

Sources7 archives

Databases and archives Oxalis oregana's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 683 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources16 traits

Occurrence & distributionGBIF2 683 records

Environmental DNA1 datasets · 0 countries8 detections

DNA & barcodingBOLD · NCBI12 specimens

01Narrative

Oxalis oregana est une espèce de plantes à fleurs du genre des Oxalis de la famille des Oxalidacées. Elle est originaire des États-Unis : Oregon mais aussi Californie et Washington.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass3.64 mg

Seed mass max4.47 mg

Seed mass min2.8 mg

Life cycle & reproduction3

Deciduousnessevergreen

Life formperennial or rhizomatous geophyte

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry3

Leaf n24.2 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)57.02 mm²/mg

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Oxalis oregana has left across the world's sequence archives.

At a glance

DNA specimens12

Marker genes4

GenBank sequences10

eDNA detections8

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMG234715.1 ↗348 bpUSA · 1987

ACGT

TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCTTTAGGCCGAGGGCACGCCTGCCTGGGTGTCACACATC …

Oxalis oregana voucher CCDB-28092-B07 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL3★rbcLa★ITS7★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type2 683 records

Wild obs. + sensor2 528

Museum / vouchered152

Cultivated / captive3

Range

Area of Occupancy AOO4 644 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 1 478≤1 km 334≤10 km 154>10 km 108

2 074 georeferenced · 454 without coordinates

Open the mapobservation + sensor2 528

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy65% within 1 km

≤100 m 4≤1 km 68≤10 km 32>10 km 7

111 georeferenced · 41 without coordinates

Open the institutions mapphysical evidence152

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 3

3 georeferenced

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Corvallis, US	75
Portland, US	23
Vancouver, CA	14
Victoria, CA	11
Ashland, US	6
Portland, US	6
Santa Cruz, US	4
HJAEFlocation not on record	2
Trois-Rivières, CA	2
Chicago, US	1
Emporia, US	1
Wuzhou, CN	1
Bronx, US	1
Uniwersytet Jagiellońskilocation not on record	1
Mexico City, MX	1
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	1
Tempe, US	1
Madison, US	1

18 institutions · 152 of 152 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA8 detections

Where the DNA of Oxalis oregana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map0 countries0

deep moist woodsredwood forestredwood forest. Undisturbed park

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Oxalis oregana

At a glance

Sources7 archives

Size & morphology3

Life cycle & reproduction3

Diet & foraging1

Habitat & environment6

Physiology & chemistry3

At a glance

Record type2 683 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions15 of 18 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type2 683 records