Oxalis micrantha

Bojer ex Progel · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Oxalidales/Oxalidaceae/Oxalis

At a glance

Occurrence records22

Data sources10

Biological traits17

DNA specimens16

eDNA detections5

Sources10 archives

Databases and archives Oxalis micrantha's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility22 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources17 traits

Occurrence & distributionGBIF22 records

Environmental DNA1 datasets · 3 countries5 detections

DNA & barcodingBOLD · NCBI16 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Oxalis micrantha, or dwarf woodsorrel, is a flowering dicot of the genus Oxalis.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTAusTraitsTRY

Size & morphology7

Fruit length3.25 mm

Fruit width1.5 mm

Leaf length12.5 mm

Leaf width12.5 mm

Petiole length7 cm

Seed length0.75 mm

Seed width0.75 mm

Life cycle & reproduction1

Life spanannual

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Fruit typecapsule

Growth formherb

Leaf compoundnesscompound

Leaf shapeobcordate obovate orbicular

Woodinessnon-woody

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Oxalis micrantha has left across the world's sequence archives.

At a glance

DNA specimens16

Marker genes8

GenBank sequences7

eDNA detections5

Countries3

The DNA barcodea real sequence read deposited for this species

ITSOQ412285.1 ↗427 bpPeru

ACGT

GCAGTTGCGCCCCAAGCCTTTAGGCCGAGGGCACGCCTGCCTGGGTGTCACACATTGTCGCCTCCAAAGCCCTCTGCTCGAAGCATTGCT …

Oxalis micrantha isolate Peru18606 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL4★rbcLa★trnL-F★ITS3★ITS1★ITS2trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Oxalis micrantha carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 91×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Naranjo, C. A., L. Mola, L. Poggio & M. M. Romero. 1982. Estudios citotaxonómicos y evolutivos en especies herbaceas Sudamericanas de Oxalis (Oxalidaceae). Bol. Soc. Argent. Bot. 20: 183–200.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=0.885 ↗

08Occurrence & distribution

Record type22 records

Museum / vouchered22

Range

Area of Occupancy AOO52 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 22 records without

Open the institutions mapphysical evidence22

10Collections & institutions

Holding institutions1 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Valparaiso, CL	14
Universidad Nacional Mayor de San Marcos, Museo de Historia Naturallocation not on record	2
San Diego Natural History Museum, Herbariumlocation not on record	1
Uniwersytet Jagiellońskilocation not on record	1
Universidad de La Serenalocation not on record	1

5 institutions · 19 of 22 vouchered records shown · 2 without an institution code

09Environmental DNA5 detections

Where the DNA of Oxalis micrantha was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map3 countries0

Scrub Oak & Mulefat., Clay & sand.

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.2 °C 12.8–16.1

Seasonal swing summer↔winter8.20 °C

Max temp (day)18.8 °C 17.8–20.3

Min temp (night)10.8 °C 9.00–14.4

Precipitation21.2 mm/mo 5.00–97.1

Air humidity63.0 % 59.7–67.9

Moisture balance-55.6 mm/mo

Vapour deficit677 Pa 502–698

Wind speed2.50 m/s

Cloud cover26.9 % 21.9–58.8

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)