Oxalis magnifica — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Oxalidales/Oxalidaceae/Oxalis

At a glance

Occurrence records25

Data sources5

Biological traits7

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Oxalis magnifica's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility25 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources7 traits

Occurrence & distributionGBIF25 records

DNA & barcodingNCBIsequences

01Narrative

Oxalis magnifica is an Oxalis species found in Oaxaca, Mexico, described in 1919.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Oxalis magnifica has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSJN618557.1 ↗687 bp

ACGT

TAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATACCTGCTTTTGCAGAACAACATGCGAATGTATTCTTGAAGGAAAA …

Oxalis magnifica isolate AG68 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS1

fungal barcode

08Occurrence & distribution

Record type25 records

Wild obs. + sensor2

Museum / vouchered23

Range

Area of Occupancy AOO72 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 2

2 georeferenced

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy86% within 1 km

≤100 m 12≤10 km 2

14 georeferenced · 9 without coordinates

Open the institutions mapphysical evidence23

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mexico City, MX	9
Saint Louis, US	4
Austin, US	4
Durango, MX	3
Davis, US	1
McWane Science Centerlocation not on record	1
MEXUlocation not on record	1

7 institutions · 23 of 23 vouchered records shown