Oxalis magellanica

G.Forst. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Oxalidales/Oxalidaceae/Oxalis

At a glance

Occurrence records1 943

Data sources11

Biological traits46

DNA specimens2

eDNA detections2

Sources11 archives

Databases and archives Oxalis magellanica's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 943 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources46 traits

Occurrence & distributionGBIF1 943 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Oxalis magellanica or snowdrop wood-sorrel is an Oxalis species found in Chile, Argentina, New Zealand, and Tasmania.Gardner, A. G. (2013). Using molecular phylogenetics to unravel morphological shifts, niche transitions, and geographic expansion at two different scales in the plant genus Oxalis (oxalidaceae) (Order No. 3588366). Available from ProQuest Dissertations & Theses Global. (1428164964). It was first described in 1789. It blooms from fall to spring with white flowers. Its native distribution is puzzling given the wide geographic separation between its populations in Oceania and South America. It, along with other members of a clade within the section Oxalis that share a common ancestor dating back to roughly 30 Ma, have a strangely complex geographic distribution. This is especially perplexing given that the connection between Oceania and South America via Antarctica disappeared 35 million years ago, before the estimated diversification of the clade.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology16

Fruit length4.5 mm

Fruit width4.5 mm

⚠ sources differ — AusTraits: 4.5 mm · GIFT: 5 mm

Leaf length7.5 mm

Leaf length max9 mm

Leaf size123 mm²

Leaf width7.5 mm

Petiole length3 cm

Plant height0.1 m

⚠ sources differ — AusTraits: 0.1 m · TRY: 0.042 m

Plant height max0.1 m

Seed length1.68 mm

Seed length max1.6 mm

Seed length min1.6 mm

Seed mass0.5 mg

⚠ sources differ — TRY: 0.5 mg · GIFT: 0 mg

Seed mass max0 mg

Seed mass min0 mg

Seed width1.09 mm

Life cycle & reproduction11

Deciduousnessevergreen

Dispersal typeself

⚠ sources differ — AusTraits: barochory · GIFT: unspecialized

Flowering timeyynnnnnnnyyy

Life formrhizomatous geophyte

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formhemicryptophyte

Reproduction asexualpresent

Resprouting capacityresprouts

Sex typehermaphrodite+monoecious

Diet & foraging1

Parasiteindependent

Habitat & environment13

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Elevation max2 000 m

Elevation min0 m

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

Habitat GIFTLowland

Leaf compoundnesscompound

Leaf shapeobcordate oblong obovate

Woodinessnon-woody

Physiology & chemistry4

Leaf dry-matter content (LDMC)160 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)34.75 mm²/mg

Other traits1

Plant support typefree-standing

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Oxalis magellanica has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences4

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSLC206077.1 ↗677 bp

ACGT

AGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATACCTGCTTGGCAGAACAACTTGAGAACGTATTTG …

Oxalis magellanica genes for 18S rRNA, ITS1, 5.8S rRNA, ITS2, 28S rRNA, partial and complete sequence, isolate: 427

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★ITS2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Oxalis magellanica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidypolyploid inferred

Chromosome records14–202n range18median18mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 182×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Azkue, D. d. 2000. Chromosome diversity of South American Oxalis (Oxalidaceae). Bot. J. Linn. Soc. 132: 143–152.

2n 141×CCDB · book-fedorov

CCDB · book-fedorov — Heitz 1926

2n 201×CCDB · new-zealand

CCDB · new-zealand

n 101×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Beuzenberg, E. J. & J. B. Hair. 1983. Contributions to a chromosome atlas of the New Zealand flora - 25 miscellaneous species. New Zealand J. Bot. 21: 13–20.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.359 ↗

07Deep time~34.2 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin34.2 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type1 943 records

Wild obs. + sensor1 560

Museum / vouchered373

Cultivated / captive2

Other8

Origin

Native8

Introduced2

Range

Area of Occupancy AOO4 752 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 1 149≤1 km 162≤10 km 99>10 km 11

1 421 georeferenced · 139 without coordinates

Open the mapobservation + sensor1 560

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy46% within 1 km

≤100 m 10≤1 km 50≤10 km 62>10 km 9

131 georeferenced · 242 without coordinates

Open the institutions mapphysical evidence373

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Auckland, NZ	75
Wellington, NZ	66
Christchurch, NZ	57
Hobart, AU	48
Museo Entomologico de Leonlocation not on record	27
Canberra, AU	22
Kew, GB	9
Mount Annan, AU	8
QVMAGlocation not on record	7
Rotorua, NZ	7
Adelaide, AU	4
Honolulu, US	3
Brisbane, AU	2
Parkville, AU	1
Castelar, AR	1
MeiseBGlocation not on record	1
Valparaiso, CL	1
Saint Louis, US	1
Smithfield, AU	1
San Isidro, AR	1
Severin-McDaniel Insect Collectionlocation not on record	1

21 institutions · 343 of 373 vouchered records shown · 30 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Oxalis magellanica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Oxalis magellanica

At a glance

Sources11 archives

Size & morphology16

Life cycle & reproduction11

Diet & foraging1

Habitat & environment13

Physiology & chemistry4

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

At a glance

When this lineage existed

Record type1 943 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions17 of 21 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type1 943 records