Ourisia muscosa

Benth. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Plantaginaceae/Ourisia

At a glance

Occurrence records129

Data sources6

Biological traits13

DNA specimens9

eDNA detections9

Sources6 archives

Databases and archives Ourisia muscosa's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility129 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Occurrence & distributionGBIF129 records

Environmental DNA1 datasets · 0 countries9 detections

DNA & barcodingBOLD · NCBI9 specimens

01Narrative

Ourisia muscosa là một loài thực vật có hoa trong họ Mã đề. Loài này được Benth. mô tả khoa học đầu tiên năm 1846.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height0.013 m

Life cycle & reproduction2

Life formperennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatemontane tropical

Climberself-supporting

Elevation max5 000 m

Elevation min3 800 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Leaf dry-matter content (LDMC)176 mg/g

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ourisia muscosa has left across the world's sequence archives.

At a glance

DNA specimens9

Marker genes3

GenBank sequences10

eDNA detections9

The DNA barcodea real sequence read deposited for this species

ITSAY613322.1 ↗636 bp

ACGT

ACCCGCGAACACGTGTTTAACATTCGGTGTCTCGACGGATTGGACNTGATTCCAGCCGCGCCGTGTCCCCCTCCCTGCCCGGAGCGCGCC …

Ourisia muscosa clone muscosCk internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS9★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type129 records

Wild obs. + sensor52

Museum / vouchered77

Range

Area of Occupancy AOO308 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy38% within 1 km

≤100 m 8≤1 km 2≤10 km 16

26 georeferenced · 26 without coordinates

Open the mapobservation + sensor52

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 17

17 georeferenced · 60 without coordinates

Open the institutions mapphysical evidence77

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Xiamen, CN	16
Aarhus, DK	14
Saint Louis, US	14
PRClocation not on record	6
La Paz, BO	5
Quito, EC	4
Stockholm, SE	3
Göteborg, SE	3
Herbario Universidad de Concepciónlocation not on record	1
Sucre, BO	1
Wellington, NZ	1
Kew, GB	1
Austin, US	1
QCNElocation not on record	1
Universidad Nacional de Colombia (UNAL)location not on record	1

15 institutions · 72 of 77 vouchered records shown · 5 without an institution code

09Environmental DNA9 detections

Where the DNA of Ourisia muscosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)