Ourisia macrocarpa

Hook.fil. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Plantaginaceae/Ourisia

At a glance

Occurrence records794

Data sources7

Biological traits3

DNA specimens0

eDNA detections1

Sources7 archives

Databases and archives Ourisia macrocarpa's data was compiled from.

GBIFGlobal Biodiversity Information Facility794 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements2 literature sources3 traits

Chemical compositionLOTUS2 compounds

Occurrence & distributionGBIF794 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 48

02Traits & measurements

SourcesWCVPTRY

Size & morphology1

Seed mass0.077 mg

Life cycle & reproduction1

Life formperennial

Habitat & environment1

Climatesubalpine or subarctic

03Chemical composition2 compounds

Compounds documented for Ourisia macrocarpa across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Ecdysteroids2

Documented compounds2 total

Tissue Source Quantified only

Compound	Class	Amount	Source
20-Hydroxyecdysone		present	LOTUS
Polypodine B		present	LOTUS

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ourisia macrocarpa has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSAY613133.1 ↗661 bp

ACGT

CATTGTCGAAACCTGCAAAGCAGACCCGCGCACACGTGTTTACATTCGGGGTCTCGGGAGGGGTGGACGTGAGTCCACCCACGCCGGGTC …

Ourisia macrocarpa var. macrocarpa voucher Meudt & Lopez 097, TEX 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Ourisia macrocarpa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 48 n = 24

Ploidypolyploid inferred

Chromosome records48–482n range48median48mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 482×CCDB · new-zealand · CCDB · ipcn-api-dl

CCDB · new-zealand

CCDB · ipcn-api-dl — Hair, J. B. & M. T. K. Arroyo. 1984. Contributions to a chromosome atlas of the New Zealand flora - 28: Ourisia (Scrophulariaceae). New Zealand J. Bot. 22: 357–361.

n 241×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Hair, J. B. & M. T. K. Arroyo. 1984. Contributions to a chromosome atlas of the New Zealand flora - 28: Ourisia (Scrophulariaceae). New Zealand J. Bot. 22: 357–361.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type794 records

Wild obs. + sensor740

Museum / vouchered54

Range

Area of Occupancy AOO1 896 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 633≤1 km 38≤10 km 33>10 km 2

706 georeferenced · 34 without coordinates

Open the mapobservation + sensor740

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 54 records without

Open the institutions mapphysical evidence54

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Christchurch, NZ	34
Wellington, NZ	15
Auckland, NZ	4
Kew, GB	1

4 institutions · 54 of 54 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Ourisia macrocarpa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)