Otiorhynchus crataegi

Germar, 1823 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Curculionidae/Otiorhynchus

At a glance

Occurrence records1 380

Data sources7

Biological traits0

DNA specimens13

eDNA detections10

Sources7 archives

Databases and archives Otiorhynchus crataegi's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 380 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 380 records

Environmental DNA1 datasets · 4 countries10 detections

DNA & barcodingBOLD13 specimens

01Narrative

Otiorhynchus crataegi, the privet weevil, is a species of broad-nosed weevil in the beetle family Curculionidae. Privet weevil, Otiorhynchus crataegi Privet weevil, Otiorhynchus crataegi

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Otiorhynchus crataegi has left across the world's sequence archives.

At a glance

DNA specimens13

BINs1

Marker genes2

eDNA detections10

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

CACCCTATATTTTATCTTTGGGGCTTGGTCTGGAATAGTGGGTACCTCGCTAAGAATACTAATTCGAGCAGAATTAGGCAACCCAGGATC …

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type1 380 records

Wild obs. + sensor1 237

Museum / vouchered131

Other12

Range

Area of Occupancy AOO2 500 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 618≤1 km 222≤10 km 209>10 km 40

1 089 georeferenced · 148 without coordinates

Open the mapobservation + sensor1 237

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy62% within 1 km

≤100 m 10≤1 km 24≤10 km 21

55 georeferenced · 76 without coordinates

Open the institutions mapphysical evidence131

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	62
SLU Artdatabankenlocation not on record	15
Natural History Museum Rotterdamlocation not on record	14
MZLUlocation not on record	12
South Kensington, GB	5
Provincia di Livornolocation not on record	3
Natural History Museum, Londonlocation not on record	2
Tilburg, NL	2
European Distributed Institute of Taxonomy (EDIT)location not on record	1
Private Collection of Dominik Rabllocation not on record	1
ZSMlocation not on record	1
MNHWlocation not on record	1
Winterthur, CH	1

13 institutions · 120 of 131 vouchered records shown · 11 without an institution code

09Environmental DNA10 detections

Where the DNA of Otiorhynchus crataegi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map4 countries0

Siedlung

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.3 °C 13.0–18.4

Seasonal swing summer↔winter17.3 °C

Max temp (day)20.2 °C 17.0–22.6

Min temp (night)11.2 °C 9.40–13.5

Precipitation64.6 mm/mo 53.9–116

Air humidity60.4 % 57.7–61.9

Moisture balance-38.2 mm/mo -62.9–19.1

Vapour deficit737 Pa 560–880

Wind speed2.90 m/s 2.40–4.40

Cloud cover36.3 % 33.7–39.0

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Otiorhynchus crataegi

At a glance

Sources7 archives

At a glance

Record type1 380 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 13 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 380 records