Oscinimorpha minutissima

(Strobl, 1900) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Chloropidae/Oscinimorpha

At a glance

Occurrence records559

Data sources6

Biological traits2

DNA specimens57

eDNA detections695

Sources6 archives

Databases and archives Oscinimorpha minutissima's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility559 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI695 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics57 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF559 records

Environmental DNA4 datasets · 11 countries695 detections

DNA & barcodingBOLD57 specimens

01Narrative

Oscinimorpha minutissima is een vliegensoort uit de familie van de halmvliegen (Chloropidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1900 door Strobl.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)phytosaprophagous

Feeding guild (larval)herbivore

05DNA & barcoding57 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Oscinimorpha minutissima has left across the world's sequence archives.

At a glance

DNA specimens57

BINs1

Marker genes1

eDNA detections695

Countries11

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P648 bp consensus54 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 10 variable positions, in barcode order

42Gvariable

123Tmostly conserved

279Gmostly conserved

303Tvariable

364Gmostly conserved

411Cvariable

423Gvariable

526Tvariable

531Gvariable

612Amostly conserved

TTCATATTCGGAGCTTGAGCAGGAATAGTAGGAACTTCATTGAGAATCCTAATTCGAGCTGAATTAGGTCATCCTGGAGCATTAATTGGA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.64%

Haplotypes5

BIN1

Most divergent pair1.5%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Olcella difficilissame family6.8%Rhopalopterum atricornesame family7.9%Conioscinella triorbiculatasame family7.9%Aphanotrigonum nigripessame family9.2%Aphanotrigonum darlingtoniaesame family9.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type559 records

Wild obs. + sensor291

Museum / vouchered260

Cultivated / captive8

Range

Area of Occupancy AOO1 068 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 224≤1 km 31≤10 km 36

291 georeferenced

Open the mapobservation + sensor291

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 233≤1 km 16

249 georeferenced · 11 without coordinates

Open the institutions mapphysical evidence260

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 8 records without

Open the mapnot free-living8

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	30
DFFW2016location not on record	14
Stockholm, SE	6
University of Tokyo, Department of Zoologylocation not on record	6
Metsähallituslocation not on record	5
SLU Artdatabankenlocation not on record	5
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	2
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	2
NTNU-VMlocation not on record	1
DFFW1981location not on record	1
Gothenburg, SE	1
South Kensington, GB	1

12 institutions · 74 of 260 vouchered records shown · 186 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA695 detections

Where the DNA of Oscinimorpha minutissima was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found695

Studies independent surveys4

Countries11

Verifiable raw sequence linked562

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 695 detections have coordinates

Open the map11 countries0

Olive orchard1.1. Boreal Forest|1. Forest & Woodland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.6 °C 13.4–17.2

Seasonal swing summer↔winter18.3 °C

Max temp (day)18.6 °C 16.2–21.2

Min temp (night)11.2 °C 10.0–13.9

Precipitation69.0 mm/mo 42.2–88.9

Air humidity59.9 % 58.0–61.6

Moisture balance-50.8 mm/mo -87.0–-26.7

Vapour deficit685 Pa 599–798

Wind speed3.50 m/s 2.40–5.00

Cloud cover44.8 % 39.9–54.8

CHELSA 1981–2010, ~9 km grid, at location & month of 670 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)