Oryza sativa
speciesAt a glance
Occurrence records280 580
Data sources15
Biological traits55
DNA specimens276
eDNA detections411
Sources15 archives
Databases and archives Oryza sativa's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility280 580 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI411 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics276 specimens↗
NCBIUS National Library of Medicinesequences↗
FooDBThe Metabolomics Innovation Centrecompounds↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources55 traits
Chemical compositionFooDB · LOTUS · NPASS6 402 compounds
Occurrence & distributionGBIF280 580 records
Environmental DNA3 datasets · 16 countries411 detections
DNA & barcodingBOLD · NCBI276 specimens
Genome at a glanceCCDB · GoaT · NCBI587 Mbp
01Narrative
Oryza sativa, le riz asiatique, est une espèce de plantes monocotylédones de la famille des Poaceae, sous-famille des Oryzoideae, originaire des régions tropicales d'Asie. Cette espèce, domestiquée il y a environ 10 000 ans, est avec le riz africain l'une des deux espèces cultivées du genre Oryza qui compte 19 espèces acceptées. Elle compte des milliers de cultivars généralement groupés en deux sous-espèces, ou groupes de cultivars,Oryza sativa subsp. indica et Oryza sativa subsp. japonica. Oryza sativa pousse au niveau de la mer et jusqu'à 2 000 mètres d'altitude, avec une tige pouvant atteindre une longueur totale de 7 mètres. C'est une plante semi-aquatique qui peut supporter des inondations ou des submersions pendant un certain temps.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTAusTraitsTRY
Size & morphology19
Fruit length6.3 mm
Fruit width2.9 mm
Inflorescence length max30 cm
Inflorescence length min20 cm
Leaf length425 mm
Leaf length max600 mm
Leaf mass per area60 g/m2
Leaf size3 003 mm²
Leaf width8.5 mm
Leaf width max10 mm
Plant height1.8 m
⚠ sources differ — GIFT: 1.8 m · AusTraits: 1.2 m
Plant height max1.5 m
Plant height min0.5 m
Seed mass26.23 mg
Seed mass max29.78 mg
Seed mass min25.62 mg
Seed volume28 mm³
Seed volume max28 mm³
Seed volume min28 mm³
Life cycle & reproduction10
Deciduousnessdeciduous
Dispersal typewind
Flowering endAug
Flowering startJul
Flowering timeyynnnnnnnnny
Life formannual or helophyte
Life spanannual
⚠ sources differ — TRY: annual · AusTraits: annual short_lived_perennial · GIFT: annual
Pollination syndromewind
Raunkiær life formtherophyte
Sex typehermaphrodite
Diet & foraging1
Parasiteindependent
Habitat & environment15
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max2 000 m
Elevation mean1 800 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typecaryopsis
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: graminoid herb · TRY: crops
Habitat GIFTÁrea Antrópica
Leaf compoundnesssimple
Leaf shapelinear
Mycorrhiza typeAMNM
Woodinessnon-woody
Physiology & chemistry8
Leaf C:N ratio13.34 g/g
Leaf c473 mg/g
Leaf dry-matter content (LDMC)271 mg/g
Leaf n26.6 mg/g
Leaf p1.7 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Specific leaf area (SLA)19.8 mm²/mg
Other traits2
Inflorescencepanicle
Shoot orientationascending
03Chemical composition6 402 compounds
Compounds documented for Oryza sativa across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cookingCereals and cereal products
Compound class profile5 classes
Aminoacids620
Pyridine alkaloids141
pteridine alkaloids115
Cinnamic acids and derivatives72
Flavones69
Documented compounds6 402 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| α-D-galactose | 78,100 mg/100g | FooDB | |
| Starch, pregelatinized | 78,100 mg/100 g | FooDB | |
| Cellulose | 43,730 mg/100g | FooDB |
05DNA & barcoding276 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Oryza sativa has left across the world's sequence archives.
At a glance
DNA specimens276
Marker genes8
GenBank sequences10
eDNA detections411
Countries16
The DNA barcodea real sequence read deposited for this species
TGTCACCACAAACAGAGACTAAAGCAAGTGTTGGATTTCAAGCTGGTGTTAAGGATTATAAATTGACTTACTACACCCCGGAGTACGAAA …
Oryza sativa isolate S3 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast
Variant network
Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.
AsiaOther
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK7★rbcL3★rbcLa★ITSatp6COIICOXIII
animal barcodeplant barcodefungal barcodemitochondrial
Organelle genome
Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.
▸ Tap any coloured segment — or a gene chip — to see what it is
Mitochondrion
NC_066488 ↗ · 37 protein · 27 tRNA · 5 rRNA
nad1cox3orf25nad5rps7orfBnad6ccmCrpl2-D2atp9ccmBatp6nad2nad9atp1rpl5cox1ccmFnrps1mat-rrps13rps4cobnad4Lrps19rpl2+11
Pick a coloured segment on the ring — or a gene chip — to read what that gene does.
protein-codingrRNAtRNA
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Oryza sativa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size586 800 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Oryza sativa0.59 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 24 n = 12
Ploidy2× diploid · measured
Chromosome records12–362n range24median24mode44records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2441×GoaT · Kew Plant DNA C-values Database · CCDB · book-ipcn65 · CCDB · ipcn-api-dl +9
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · book-ipcn65 — Ghosh 1964
CCDB · ipcn-api-dl — Chen, R., W. Song, Z. An & X. Li. 1982a. Studies on cotton Gossypium hirsutum karyotype. Acta Bot. Sin. 24(1): 94–97.
CCDB · ipcn-api-dl — Chen, Y. j. & H. k. Wu. 1982. A comparison of karyotypes among six Oryza species. Bot. Bull. Acad. Sin. 23: 163–183.
CCDB · ipcn-api-dl — Wakasa, K. & Y. Watanabe. 1979. Haploid plant of Oryza perennis (spontanea type) induced by anther culture. Jap. J. Breed. 29: 146–150.
CCDB · ipcn-api-dl — Yao, Z. 1984. Chromosome Giemsa N-banding in rice. Acta Genet. Sin. 11: 207–210.
CCDB · ipcn-api-dl — Cheng, Y. C., Y. C. Duan & Z. Q. Tian. 1983. A study of chromosome banding pattern analysis of chromosome in the hybrid rice and three lines. Hunan Nongye Xueyuan (J. Hunan Coll. Agric.). (2): 53–61. (In Chinese).
CCDB · ipcn-api-dl — Fukui, K. 1986. Comparison between Giemsa and orcein staining method in rice chromosomes. Kromosomo 43–44: 1398–1404.
CCDB · ipcn-api-dl — Shu, L. H. & G. T. Qu. 1985. The karyotype analysis of rice based on somatic cells in callus. J. Wuhan Bot. Res. 3(4): 418.
CCDB · ipcn-api-dl — Shu, L. H., W. Y. Deng & G. P. Li. 1985. The karyotype analysis of rice (Oryza sativa). J. Wuhan Bot. Res. 3(4): 413–417.
CCDB · ipcn-api-dl — Mukherjee, P. & A. R. Debnath. 1987. Karyotypic divergence in some rice mutants (Oryza sativa L.). Proc. Indian Sci. Congr. Assoc. 74(3,VI): 100–101.
CCDB · ipcn-api-dl — Mukherjee, P. & A. R. Debnath. 1987. Karyotypic divergence in some rice mutants (Oryza sativa L.). Proc. Indian Sci. Congr. Assoc. 74(3,VI): 102–103.
CCDB · ipcn-api-dl — Reddi, V. R. & B. Subba/Rao. 1989. Perspectives in chromosome analysis in rice. Aspects Pl. Sci. 10: 113–119.
CCDB · ipcn-api-dl — Mukherjee, P. & A. R. Debnath. 1988. Gamma-ray induces asynaptic and desynaptic mutants in rice Oryza sativa L. Proc. Indian Sci. Congr. Assoc. 75(3–X): 49.
CCDB · ipcn-api-dl — Chen, Z. j. & L. h. Zhu. 1990. Karyotype analysis of Lu Dao: an indigenous rice germplasm of Jiangsu Province. Acta Genet. Sin. 17: 1–5.
CCDB · ipcn-api-dl — Shi, Y., J. Draper & C. Stace. 1993. Ribosomal DNA variation and its phylogenetic implication in the genus Brachypodium (Poaceae). Pl. Syst. Evol. 188: 125–138.
CCDB · ipcn-api-dl — Ma, D. h. 1995. Primary research on the karyotypes of four cultivars of rice in Ningxia. J. Ningxia Agric. Coll. 16(2): 75–78.
CCDB · ipcn-api-dl — Duan, C. z., N. s. Zhuang & J. d. Li. 1994. A study of the satellite banding on chromosomes of rice (Oryza sativa L.). J. SouthW. Agric. Univ. 16(4): 387–389.
CCDB · ipcn-api-dl — Yan, H. h., H. y. Hu, Q. Fu, H. y. Yu, S. x. Tang, Z. m. Xiong & S. k. Min. 1996. Morphological and cytogenetical studies of the hybrids between Oryza sativa and O. officinalis. Chin. J. Rice Sci. 10(3): 138–142.
CCDB · ipcn-api-dl — Hu, W. h., L. h. Su, Y. c. Song, L. l. Zhu & G. c. He. 2000. Chromosome identification in a hybrid of Oryza sativa @x O. officinalis by genomic in situ hybridization. J. Wuhan Bot. Res. 18(2): 81–89.
CCDB · ipcn-api-dl — Zhang, C. s. 1998. A preliminary study on making plant chromosomal specimens using peppermint oil compound as pretreatment agent. J. Wuhan Bot. Res. 16(3): 280–282.
CCDB · ipcn-api-dl — Dolores, R. C., T. T. Chang & D. A. Ramirez. 1979. The cytogenetics of Fl hybrids from Oryza nivara Sharma & Shastry X O. sativa L. Cytologia 44: 527–540.
CCDB · ipcn-api-dl — Krishnamurthy, I. V. 1978. Karyomorphological studies in some paddy varieties (Oryza sativa Linn.). Proc. Indian Sci. Congr. Assoc. (III, C) 65: 101.
CCDB · ipcn-api-dl — Chen, R. y., W. q. Song, X. l. Li, M. x. Li, G. l. Liang, Z. p. An, C. b. Chen, Z. x. Qi & Y. z. Sun. 2003. Chromosome Atlas of Major Economic Plants Genome in China, Vol. 2, Chromosome Atlas of Crops and their Wild Kindred Plants in China Relatives. Science Press, Beijing.
CCDB · ipcn-api-dl — Nakayama, S. 2005. Molecular cytological diversity in cultivated rice Oryza sativa subspecies japonica and indica. Breed. Sci. 55: 425–430.
CCDB · ipcn-api-dl — Suzuki, H., Y. Futsuhara, F. Takaiwa & N. Kurata. 1991. Localization of glutelin gene in rice chromosome by in situ hybridization. Jap. J. Genet. 66: 305–312.
CCDB · ipcn-api-dl — Dane, F. & C. Meric. 2005. Cytological and embryological studies of anther in rice (Oryza sativa) cv. 'Rocca'. Acta Bot. Hung. 47(3–4): 257–272.
CCDB · book-ipcn66 — Mitsukuri 1966
CCDB · book-ipcn72 — NISHI, T., & s. MITSUOKA. 1969. Occurrence of various ploidy plants from anther and ovary culture of rice plant. Jap. J. Genet. 44: 341-346.
CCDB · book-ipcn67-71 — GOULD, F.W., & T.R. SODERSTROM. 1970. Chromosome numbers of some Mexican and Colombian grasses. Canad. J. Bot. 48: 1633-1639.
CCDB · book-ipcn73-74 — WATANABE, Y., & S. ONO. 1973. Cytogenetic studies on the artificial polyploids in the genus Oryz{. sterile amphiploids, sativa-officinalis- (AACC). Jap. J. Breeding 23 2): 67-70.
CCDB · book-ipcn73-74 — GOULD, F.W., & T.R. SODERSTROM. 1974. Chromosome numbers of some Ceylon grasses. Canad. J. Bot. 52: 1075-1090.
CCDB · eflora
CCDB · book-atlas-flowering-plants
CCDB · book-atlas-flowering-plants — Gotoh & O. 1933
CCDB · Cave1958 — Mitsukuri et al. 1958
CCDB · Cave1962 — Bouharmont 1962
CCDB · Cave1963 — Larsen 1963b
2n 122×CCDB · ipcn-api-dl · CCDB · Cave1958
CCDB · ipcn-api-dl — Hamoud, M. A., Y. A. Hassan, W. Nagl & E. E. Selim. 1991. C-Banded karyotypes of seven cultivars of Oryza sativa. Cytologia 56: 319–325.
CCDB · Cave1958 — Hu, 1958
2n 131×CCDB · book-ipcn75-78
CCDB · book-ipcn75-78 — NA
2n 361×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Annie, P. T. & P. G. Nair. 1992. Cytology of endosperm in Oryza sativa L. and O. malampuzhensis Krishn. et Chandr. Cytologia 57: 265–266.
n 1213×CCDB · ipcn-api-dl · CCDB · book-ipcn66 · CCDB · book-ipcn67-71 +3
CCDB · ipcn-api-dl — Wakasa, K. & Y. Watanabe. 1979. Haploid plant of Oryza perennis (spontanea type) induced by anther culture. Jap. J. Breed. 29: 146–150.
CCDB · ipcn-api-dl — Kumaran, K. & P. M. Menon. 1982. Cytological studies of sterility in ten indica hybrids of Olyza sativa L. Cytologia 47: 525–534.
CCDB · ipcn-api-dl — Mukherjee, P. & A. R. Debnath. 1987. Karyotypic divergence in some rice mutants (Oryza sativa L.). Proc. Indian Sci. Congr. Assoc. 74(3,VI): 102–103.
CCDB · ipcn-api-dl — Kishor, P. B. K., M. Aruna & G. M. Reddy. 1989. Plant regeneration from haploid callus of Indica rice. Proc. Indian Natl. Sci. Acad., B 55: 193–202.
CCDB · book-ipcn66 — Katayama 1966a, b
CCDB · book-ipcn67-71 — OKA, H. -s. 1968. Preferential pairing of 'chromosomes in a tetraploid hybrid between Oryza glaberrima and Q. sativa. Canad. J. Genet. Cytol. 10: 527-535.
CCDB · book-ipcn67-71 — BASAK, S.L., & S. DANA. 1967. Structural differentiation in natural populations of Oryza sativa species complex. Nucleus 10: 15-22.
CCDB · book-ipcn73-74 — DAVIDSE, G., & R.W. POHL. 1974. Chromosome numbers, meiotic behavior, and notes on tropical American grasses (Gramineae). Canad. J. Bot. 52: 317-328.
CCDB · Cave1962 — Hu 1962
CCDB · Cave1963 — Sen 1963
n 111×CCDB · book-ipcn75-78
CCDB · book-ipcn75-78 — NA
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelComplete Genome
Completeness98.3% BUSCO
08Occurrence & distribution
Record type280 580 records
Wild obs. + sensor10 883
Museum / vouchered3 220
Cultivated / captive7 905
Other258 572
Origin
Native45
Introduced59
Range
Area of Occupancy AOO48 128 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy97% within 1 km
≤100 m 10 104≤1 km 124≤10 km 231>10 km 58
10 517 georeferenced · 366 without coordinates
Open the mapobservation + sensor10 883
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy54% within 1 km
≤100 m 79≤1 km 140≤10 km 151>10 km 34
404 georeferenced · 2 816 without coordinates
Open the institutions mapphysical evidence3 220
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤1 km 1≤10 km 1 888>10 km 1 548
3 437 georeferenced · 4 468 without coordinates
Open the mapnot free-living7 905
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions130 of 239 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Paris, FR | 470 |
| US | 227 |
| Saint Louis, US | 115 |
| Istituto Agrario Castelnuovolocation not on record | 106 |
| Beijing, CN | 67 |
| Taipei, TW | 61 |
| Guilin, CN | 46 |
| Bronx, US | 43 |
| PUC-RSlocation not on record | 43 |
| Guangzhou, CN | 42 |
| UnBlocation not on record | 41 |
| PNHlocation not on record | 37 |
| National Biodiversity Institute, Costa Ricalocation not on record | 37 |
| South Kensington, GB | 35 |
| Canberra, AU | 34 |
| University of Stellenboschlocation not on record | 29 |
| KMCClocation not on record | 28 |
| Mexico City, MX | 24 |
| Kew, GB | 22 |
| Sanda, JP | 22 |
| Canadian Department of Agriculturelocation not on record | 22 |
| Durango, MX | 20 |
| Xiamen, CN | 20 |
| Bloomington, US | 19 |
| CICYTEXlocation not on record | 16 |
| Baroda, IN | 16 |
| Davis, US | 12 |
| Riverside, US | 12 |
| National Institute of Biological Resourceslocation not on record | 12 |
| Moscow State Universitylocation not on record | 10 |
| MeiseBGlocation not on record | 10 |
| Philadelphia, US | 9 |
| Zapopan, MX | 9 |
| Kunming, CN | 9 |
| Barcelona, ES | 9 |
| St. Augustine, TT | 9 |
| Kochi, JP | 9 |
| Santa Barbara, US | 9 |
| Museo Entomologico de Leonlocation not on record | 8 |
| Servico de Microbiologia e Imunologialocation not on record | 8 |
| HNBlocation not on record | 7 |
| Brisbane, AU | 7 |
| Universidad de Caldas (UCaldas)location not on record | 7 |
| San Isidro, AR | 7 |
| Tsukuba, JP | 6 |
| Mérida, MX | 6 |
| Yaoundé, CM | 6 |
| Universidad Nacional de Colombia (UNAL)location not on record | 6 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 6 |
| Taipei, TW | 6 |
| Adam Mickiewicz University in Poznańlocation not on record | 6 |
| Claremont, US | 5 |
| Aarhus, DK | 5 |
| Mount Annan, AU | 5 |
| Mexico City, MX | 5 |
| Odawara, JP | 5 |
| UFMSlocation not on record | 5 |
| Jackson, US | 5 |
| Pretoria, ZA | 5 |
| Salvador, BR | 5 |
| València, ES | 5 |
| Tampa, US | 4 |
| Sevilla, ES | 4 |
| MAlocation not on record | 4 |
| Berlin, DE | 4 |
| UNITINSlocation not on record | 4 |
| San Diego, US | 4 |
| Corrientes, AR | 4 |
| Chapingo, MX | 4 |
| Edinburgh, GB | 4 |
| EFGlocation not on record | 4 |
| International Rice Research Institutelocation not on record | 4 |
| UFRRJlocation not on record | 4 |
| Chongqing Museumlocation not on record | 4 |
| Mérida, MX | 4 |
| Armidale, AU | 4 |
| Palmerston, AU | 4 |
| Miami, US | 4 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 4 |
| Embrapa Amazônia Oriental, Ministry of Agriculturelocation not on record | 4 |
| Taipei, TW | 4 |
| Centre National de la Recherche Scientifique et Technologique / Institut de l'environnement et de recherches agricoleslocation not on record | 4 |
| Ivano-Frankivsk, UA | 3 |
| Hobart, AU | 3 |
| Université de Bordeauxlocation not on record | 3 |
| Tartu, EE | 3 |
| Area de Conservacion Guanacastelocation not on record | 3 |
| Philippine Rice Research Institutelocation not on record | 3 |
| UFBAlocation not on record | 3 |
| Akita Prefectural Museumlocation not on record | 3 |
| Chiba, JP | 3 |
| Fukushima Universitylocation not on record | 3 |
| Stockholm, SE | 3 |
| Dresden, DE | 3 |
| Brasília, BR | 3 |
| Sagamihara, JP | 3 |
| TAIElocation not on record | 3 |
| Smithfield, AU | 3 |
| Adelaide, AU | 3 |
| BAYLUlocation not on record | 3 |
| San José, CR | 3 |
| Antiguo Cuscatlán, SV | 3 |
| Toyama, JP | 2 |
| Loja, EC | 2 |
| CASlocation not on record | 2 |
| BDBClocation not on record | 2 |
| Otaru, JP | 2 |
| León, NI | 2 |
| WAGlocation not on record | 2 |
| GJOlocation not on record | 2 |
| Kensington, AU | 2 |
| Washington, US | 2 |
| Nishihara, JP | 2 |
| Blumenau, BR | 2 |
| UEMAlocation not on record | 2 |
| UNESClocation not on record | 2 |
| Université du Lomélocation not on record | 2 |
| UIBlocation not on record | 2 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 2 |
| Austin, US | 2 |
| Nishihara, JP | 2 |
| Bangkok, TH | 2 |
| Tuscaloosa, US | 2 |
| Auckland, NZ | 2 |
| Clemson, US | 2 |
| Fayetteville, US | 2 |
| Little Rock, US | 2 |
| San Luis Obispo, US | 2 |
| Osaka, JP | 2 |
| UNESP-FCAlocation not on record | 2 |
| Frankfurt am Main | 2 |
| Oskarshamn, SE | 2 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 2 |
| Uniwersytet Jagiellońskilocation not on record | 2 |
| Pondicherry, IN | 2 |
| Sendai, JP | 2 |
| UFPIlocation not on record | 2 |
| Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record | 2 |
| Fort Worth, US | 2 |
| BClocation not on record | 2 |
| Criciúma, BR | 2 |
| Bando, JP | 2 |
| Cenargenlocation not on record | 2 |
| Universidad Nacional Autónoma de Honduraslocation not on record | 1 |
| Alicante, ES | 1 |
| Plocation not on record | 1 |
| Firenze, IT | 1 |
| Nagatoro-machi, Chichibu-gun, JP | 1 |
| Guatemala City, GT | 1 |
| Ann Arbor, US | 1 |
| Muzaffarabad, PK | 1 |
| QAUlocation not on record | 1 |
| Forest Herbarium Ibadan (FHI)location not on record | 1 |
| Uniwersytet Śląski w Katowicachlocation not on record | 1 |
| Podgorica, ME | 1 |
| Logan, US | 1 |
| Lubbock, US | 1 |
| DMZ botanic gardenlocation not on record | 1 |
| Irkutsk State Universitylocation not on record | 1 |
| Herbario Universidad de Concepciónlocation not on record | 1 |
| Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record | 1 |
| Cuiabá, BR | 1 |
| Olocation not on record | 1 |
| Austin, US | 1 |
| Chicago, US | 1 |
| Laboratorio de Ictiologialocation not on record | 1 |
| IPA/SPlocation not on record | 1 |
| Chengdu, CN | 1 |
| James Cook Townsvillelocation not on record | 1 |
| KURAlocation not on record | 1 |
| Montréal, CA | 1 |
| Universidade Federal do Maranhãolocation not on record | 1 |
| Johnson City, US | 1 |
| Parthenon Tama History Museumlocation not on record | 1 |
| JBSlocation not on record | 1 |
| JBRJlocation not on record | 1 |
| Universidad Autónoma de Nayaritlocation not on record | 1 |
| Quito, EC | 1 |
| Wlocation not on record | 1 |
| Flagstaff, US | 1 |
| Universidad de El Salvadorlocation not on record | 1 |
| Denver, US | 1 |
| Chapel Hill, US | 1 |
| La Paz, BO | 1 |
| Chadron, US | 1 |
| College of the Atlantic, Museumlocation not on record | 1 |
| Arcata, US | 1 |
| Qarshi Botanical Gardenlocation not on record | 1 |
| Catalina Island Conservancylocation not on record | 1 |
| Kushiro City Museumlocation not on record | 1 |
| Bratislava, SK | 1 |
| Northridge, US | 1 |
| Provo, US | 1 |
| UEMlocation not on record | 1 |
| Entomological Society of Latvialocation not on record | 1 |
| KR | 1 |
| WTUlocation not on record | 1 |
| ISAlocation not on record | 1 |
| J.F.Oberlin Universitylocation not on record | 1 |
| CNF-UFHBlocation not on record | 1 |
| Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record | 1 |
| BMlocation not on record | 1 |
| Wuzhou, CN | 1 |
| Mexico City, MX | 1 |
| Museu Paraense Emílio Goeldilocation not on record | 1 |
| Dehra Dun, IN | 1 |
| Montecillo, Texcoco, MX | 1 |
| Torreón, MX | 1 |
| UEPAlocation not on record | 1 |
| UFVJMlocation not on record | 1 |
| Departamento de Sistematica e Ecologialocation not on record | 1 |
| MEXUlocation not on record | 1 |
| UNESP-RClocation not on record | 1 |
| University of the Philippines Los Banoslocation not on record | 1 |
| Nagano City, JP | 1 |
| Universität Tübingenlocation not on record | 1 |
| Université National du Béninlocation not on record | 1 |
| Pamplona, ES | 1 |
| Puerto Ayora, EC | 1 |
| Uppsala, SE | 1 |
| Bern, CH | 1 |
| Herbier National du Gabonlocation not on record | 1 |
| Vitoria, ES | 1 |
| Davenport, US | 1 |
| J.F. Maxwelllocation not on record | 1 |
| LDlocation not on record | 1 |
| ASUlocation not on record | 1 |
| Pittsburg, US | 1 |
| Elocation not on record | 1 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 1 |
| ESP004location not on record | 1 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 1 |
| Ciudad de México, MX | 1 |
| Universidad de Antioquia (UdeA)location not on record | 1 |
| Giardini Botanici Hanburylocation not on record | 1 |
| California Academy of Scienceslocation not on record | 1 |
| UNIVASFlocation not on record | 1 |
| Universidade Federale do Rio Grande do Sullocation not on record | 1 |
| Valdosta State Universitylocation not on record | 1 |
239 institutions · 2 219 of 3 220 vouchered records shown · 844 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA411 detections
Where the DNA of Oryza sativa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found411
Studies independent surveys3
Countries16
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 411 detections have coordinates
Open the map16 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Measured at samplingin-field
Temperature20.5 °C 11.7–30.9
pH8.14 7.03–8.71
Conductivity49,200 µS/cm 27,300–59,392
Salinity35.4 PSU 24.0–39.7
Dissolved oxygen7.72 mg/L 6.80–10.5
Turbidity0.295 NTU 0.009–22.2
Nitrate0.7 µmol/L 0.091–11.6
Depth2.00 m 0–100
Coastal waterPelagicSediment
126 samples with on-site data · median with range · describes the sample, not the organism
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median24.9 °C 15.5–25.1
Seasonal swing summer↔winter9.30 °C
Max temp (day)27.4 °C 17.1–30.5
Min temp (night)19.3 °C 13.0–21.3
Precipitation109 mm/mo 50.4–224
Air humidity56.8 % 52.0–62.1
Moisture balance-17.8 mm/mo
Vapour deficit1,229 Pa 730–1,616
Wind speed2.40 m/s
Cloud cover25.2 % 20.9–52.1
CHELSA 1981–2010, ~9 km grid, at location & month of 346 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.