Orthotylus tenellus

(Fallen, 1807) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Miridae/Orthotylus

At a glance

Occurrence records998

Data sources7

Biological traits0

DNA specimens14

eDNA detections93

Sources7 archives

Databases and archives Orthotylus tenellus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility998 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI93 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF998 records

Environmental DNA4 datasets · 6 countries93 detections

DNA & barcodingBOLD14 specimens

01Narrative

Orthotylus tenellus is a species of bug from a family of Miridae that can be found in Benelux, Eastern Europe (except for Lithuania and Russia), Czech Republic, France, Germany, Greece, Italy, Moldova, Poland, Scandinavia, Slovakia, the United Kingdom, and northern states of former Yugoslavia.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Orthotylus tenellus has left across the world's sequence archives.

At a glance

DNA specimens14

BINs1

Marker genes1

eDNA detections93

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P657 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 80% of positions are identical in every specimen.

Diversity (π)4.4%

Haplotypes2

BIN1

Most divergent pair19.5%

Where individuals differ — all 129 variable positions, in barcode order

2Cmostly conserved

4Cmostly conserved

6Tmostly conserved

12Cmostly conserved

30Amostly conserved

33Amostly conserved

37Tmostly conserved

39Amostly conserved

42Gmostly conserved

45Amostly conserved

49Cmostly conserved

60Cmostly conserved

63Tmostly conserved

66Tmostly conserved

69Cmostly conserved

79Gmostly conserved

80Cmostly conserved

81Cmostly conserved

84Amostly conserved

87Cmostly conserved

96Cmostly conserved

99Amostly conserved

102Cmostly conserved

110Cmostly conserved

111Cmostly conserved

123Tmostly conserved

126Amostly conserved

132Tmostly conserved

135Cmostly conserved

144Tmostly conserved

162Gmostly conserved

168Amostly conserved

171Cmostly conserved

180Amostly conserved

183Amostly conserved

186Cmostly conserved

192Cmostly conserved

196Cmostly conserved

205Tmostly conserved

216Amostly conserved

222Cmostly conserved

225Cmostly conserved

237Amostly conserved

246Cmostly conserved

249Tmostly conserved

264Amostly conserved

265Cmostly conserved

273Tmostly conserved

276Amostly conserved

279Tmostly conserved

282Tmostly conserved

286Cmostly conserved

289Gmostly conserved

291Amostly conserved

297Tmostly conserved

301Amostly conserved

302Tmostly conserved

303Tmostly conserved

304Gmostly conserved

312Cmostly conserved

315Tmostly conserved

321Tmostly conserved

324Gmostly conserved

327Amostly conserved

336Cmostly conserved

339Cmostly conserved

342Amostly conserved

345Cmostly conserved

348Tmostly conserved

366Tmostly conserved

378Tmostly conserved

381Tmostly conserved

385Cmostly conserved

399Cmostly conserved

400Cmostly conserved

405Cmostly conserved

406Cmostly conserved

411Cmostly conserved

414Tmostly conserved

415Gmostly conserved

417Gmostly conserved

426Tmostly conserved

429Tmostly conserved

435Cmostly conserved

441Tmostly conserved

444Tmostly conserved

453Tmostly conserved

457Cmostly conserved

459Cmostly conserved

462Cmostly conserved

469Cmostly conserved

471Cmostly conserved

472Gmostly conserved

474Amostly conserved

477Tmostly conserved

481Amostly conserved

483Cmostly conserved

484Cmostly conserved

486Cmostly conserved

492Amostly conserved

495Tmostly conserved

499Cmostly conserved

507Cmostly conserved

528Tmostly conserved

531Cmostly conserved

534Amostly conserved

537Tmostly conserved

538Cmostly conserved

547Cmostly conserved

552Amostly conserved

555Tmostly conserved

558Amostly conserved

561Cmostly conserved

567Amostly conserved

576Gmostly conserved

579Tmostly conserved

580Cmostly conserved

582Tmostly conserved

594Tmostly conserved

597Tmostly conserved

+9 more variable positions not shown

ACCCTTTACTTCATATTTGGTATATGAGCAGGAATATTAGGGACATCCCTAAGATGAATCATTCGTATCGAATTAGGAGCCCCAGGCTCA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Parthenicus brindleyisame family15.8%Orthotylus boreellussame genus15.9%Pseudoloxops coccineussame family16.0%Orthotylus rubidussame genus16.1%Dimorphocoris tristissame family16.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type998 records

Wild obs. + sensor848

Museum / vouchered125

Other25

Range

Area of Occupancy AOO2 620 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy62% within 1 km

≤100 m 351≤1 km 160≤10 km 304>10 km 3

818 georeferenced · 30 without coordinates

Open the mapobservation + sensor848

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy77% within 1 km

≤100 m 49≤1 km 30≤10 km 23

102 georeferenced · 23 without coordinates

Open the institutions mapphysical evidence125

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Natural History Museum, Aarhus Denmarklocation not on record	32
SLU Artdatabankenlocation not on record	16
Philadelphia, US	8
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	7
CBDClocation not on record	6
NHMOlocation not on record	4
ZSMlocation not on record	3
NCMGlocation not on record	3
Uniwersytet Śląski w Katowicachlocation not on record	1
ZMAAlocation not on record	1
Forssa, FI	1

11 institutions · 82 of 125 vouchered records shown · 43 without an institution code

09Environmental DNA93 detections

Where the DNA of Orthotylus tenellus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found93

Studies independent surveys4

Countries6

Verifiable raw sequence linked75

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 93 detections have coordinates

Open the map6 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.2 °C 10.2–14.8

Seasonal swing summer↔winter17.8 °C

Max temp (day)17.9 °C 14.6–19.2

Min temp (night)10.0 °C 5.70–11.1

Precipitation62.9 mm/mo 40.8–88.9

Air humidity59.7 % 58.0–61.3

Moisture balance-47.8 mm/mo -64.0–-13.0

Vapour deficit623 Pa 522–698

Wind speed3.20 m/s 2.50–4.40

Cloud cover42.7 % 38.5–51.7

CHELSA 1981–2010, ~9 km grid, at location & month of 93 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)