Ornithonyssus sylviarum

(Canestrini & Fanzago, 1877) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Mesostigmata/Macronyssidae/Ornithonyssus

At a glance

Occurrence records793

Data sources7

Biological traits0

DNA specimens89

eDNA detections88

Sources7 archives

Databases and archives Ornithonyssus sylviarum's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility793 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI88 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics89 specimens↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF793 records

Environmental DNA1 datasets · 2 countries88 detections

DNA & barcodingBOLD89 specimens

Genome at a glanceGoaT2n = 18

01Narrative

Ornithonyssus sylviarum (also known as the northern fowl mite) is a haematophagous ectoparasite of poultry. In both size and appearance, it resembles the red mite, Dermanyssus gallinae. This blood-feeding parasite is broadly distributed, and has been reported on 72 host species of North American birds in 26 families. The mites have been a major pest of the poultry industry since the early 1900s.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding89 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ornithonyssus sylviarum has left across the world's sequence archives.

At a glance

DNA specimens89

BINs2

Marker genes2

eDNA detections88

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P324 bp consensus83 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 8 variable positions, in barcode order

6Cmostly conserved

48Avariable

99Avariable

134Gmostly conserved

184Tvariable

222Cvariable

255Cmostly conserved

309Gvariable

GTTTACCCTCCACTTTCTAGAAATATTTCACATAGAGGTAAATCAGTAGATCTAGCTATTTTTAGACTTCATATTGCTGGTATTTCTTCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.1%

Haplotypes24

BINs2

Most divergent pair3.1%

N.AmericaAsiaOtherEurope

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Ornithonyssus sylviarum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 181×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

08Occurrence & distribution

Record type793 records

Wild obs. + sensor4

Museum / vouchered789

Range

Area of Occupancy AOO588 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 3

3 georeferenced · 1 without coordinates

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy73% within 1 km

≤100 m 83≤1 km 30≤10 km 31>10 km 10

154 georeferenced · 635 without coordinates

Open the institutions mapphysical evidence789

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Ohio State University Acarology Laboratory, Columbus, OH (OSAL)location not on record	169
Harold Winfred Manter Laboratory of Parasitologylocation not on record	124
Natick, US	77
DPIlocation not on record	60
Mexico City, MX	36
San Nicolás de los Garza, MX	32
DOI/NPS, Salem Maritime National Historic Sitelocation not on record	14
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	11
MZLUlocation not on record	7
University of Guelph, Centre for Biodiversity Genomicslocation not on record	4
Edmonton, CA	2
Cambridge, US	1
University of Tokyo, Department of Zoologylocation not on record	1
SOVTlocation not on record	1

14 institutions · 539 of 789 vouchered records shown · 250 without an institution code

09Environmental DNA88 detections

Where the DNA of Ornithonyssus sylviarum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found88

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 88 detections have coordinates

Open the map2 countries0

UrbanForestMixed habitatPoultry house

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.3 °C 14.7–21.5

Seasonal swing summer↔winter25.7 °C

Max temp (day)19.2 °C 18.5–24.6

Min temp (night)13.6 °C 11.2–19.6

Precipitation94.8 mm/mo 74.5–126

Air humidity58.0 % 57.4–62.1

Moisture balance71.2 mm/mo

Vapour deficit738 Pa 711–1,071

Wind speed2.70 m/s

Cloud cover41.5 % 39.3–49.6

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)