Ornithogalum saundersiae

Baker · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Asparagaceae/Ornithogalum

At a glance

Occurrence records84

Data sources11

Biological traits18

DNA specimens0

eDNA detections3

Sources11 archives

Databases and archives Ornithogalum saundersiae's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility84 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources18 traits

Chemical compositionLOTUS · NPASS56 compounds

Occurrence & distributionGBIF84 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 12

01Narrative

Ornithogalum saundersiae, or giant chincherinchee, is a species of Ornithogalum (star of Bethlehem) in the subfamily Scilloideae of family Asparagaceae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Size & morphology5

Plant height max1.5 m

Plant height min0.38 m

Seed mass10.76 mg

Seed mass max14.8 mg

Seed mass min6.72 mg

Life cycle & reproduction3

Life formbulbous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max1 525 m

Elevation min305 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

03Chemical composition56 compounds

Compounds documented for Ornithogalum saundersiae across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Cholestane steroids39

Furostane steroids24

Ergostane steroids4

Merosesquiterpenoids1

Documented compounds56 total

Tissue Source Quantified only

Compound	Amount	Source
(1R,2S,4S,6R,7S,8S,9R,10R,13S,14R,17S)-17-[(2R,3R,4S,5S,6R)-3-[(2S,3R,4S,5S,6R)-4,5-dihydroxy-6-(hydroxymethyl)-3-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-2-yl]oxy-4,5-dihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-6-hydroxy-8,14-dimethyl-7-(2-methylprop-1-enyl)-5-oxapentacyclo[11.8.0.02,10.04,9.014,19]henicos-19-ene-10-carbaldehyde	present	LOTUS
(1R,2S,4S,6R,7S,8S,9R,10R,13S,14R,17S)-17-[(2R,3R,4S,5S,6R)-4,5-dihydroxy-6-(hydroxymethyl)-3-[(2S,3R,4R,5R,6R)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-2-yl]oxy-6-hydroxy-8,14-dimethyl-7-(2-methylprop-1-enyl)-5-oxapentacyclo[11.8.0.02,10.04,9.014,19]henicos-19-ene-10-carbaldehyde	present	LOTUS
(1R,2S,4S,6R,7S,8S,9R,10R,13S,14R,17S)-17-[(2R,3R,4S,5S,6R)-4,5-dihydroxy-6-(hydroxymethyl)-3-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-2-yl]oxy-6-hydroxy-8,14-dimethyl-7-(2-methylprop-1-enyl)-5-oxapentacyclo[11.8.0.02,10.04,9.014,19]henicos-19-ene-10-carbaldehyde	present	LOTUS
(1S,2R,4S,6S,7R,8R,9S,10S,13R,14R,17R)-17-[(2R,3R,4R,5S,6R)-4,5-dihydroxy-6-(hydroxymethyl)-3-[(2R,3R,4S,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-2-yl]oxy-6-hydroxy-8,14-dimethyl-7-(2-methylprop-1-enyl)-5-oxapentacyclo[11.8.0.02,10.04,9.014,19]henicos-19-ene-10-carbaldehyde	present	LOTUS
(1S,2R,4S,6S,7R,8R,9S,10S,13S,14R,17R)-17-[(2S,3S,4R,5R,6S)-3-[(2R,3S,4R,5R,6S)-4,5-dihydroxy-6-(hydroxymethyl)-3-[(2R,3S,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-2-yl]oxy-4,5-dihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-6-hydroxy-8,14-dimethyl-7-(2-methylprop-1-enyl)-5-oxapentacyclo[11.8.0.02,10.04,9.014,19]henicos-19-ene-10-carbaldehyde	present	LOTUS
(1S,2S,4S,7S,8S,9R,10S,13S,14R,15R,17R)-17-hydroxy-8,10,14-trimethyl-7-(2-methylprop-1-enyl)-15-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-[[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxymethyl]oxan-2-yl]oxy-5-oxapentacyclo[11.8.0.02,10.04,9.014,19]henicos-19-en-6-one	present	LOTUS
(2R,3R,4R,5R,6S)-2-[[(3R,8S,9S,10R,11R,13S,14S,16S,17S)-3,11-dihydroxy-17-[(2S,3S)-3-hydroxy-6-methylheptan-2-yl]-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-16-yl]oxy]-6-methyloxane-3,4,5-triol	present	LOTUS
(2R,3R,4R,5R,6S)-2-[[(3S,8S,9S,10R,11R,13S,14S,16S,17R)-3,11-dihydroxy-17-[(2S,3S)-3-hydroxy-6-methylhept-5-en-2-yl]-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-16-yl]oxy]-6-methyloxane-3,4,5-triol	present	LOTUS
(2R,3R,4R,5R,6S)-2-[[(3S,8S,9S,10R,11R,13S,14S,16S,17R)-3,11-dihydroxy-17-[(2S,3S)-3-hydroxy-6-methylheptan-2-yl]-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-16-yl]oxy]-6-methyloxane-3,4,5-triol	present	LOTUS
(2R,3R,4R,5R,6S)-2-[[(3S,8S,9S,10R,11R,13S,14S,16S,17S)-3,11-dihydroxy-17-[(2S,3S)-3-hydroxy-6-methylheptan-2-yl]-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-16-yl]oxy]-6-methyloxane-3,4,5-triol	present	LOTUS

05DNA & barcoding4 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ornithogalum saundersiae has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences4

eDNA detections3

The DNA barcodea real sequence read deposited for this species

ITSHQ615139.1 ↗814 bp

ACGT

CGCCCGTGACGTCGCGAGAAGTCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAG …

Ornithogalum saundersiae voucher ABH 50132 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Ornithogalum saundersiae carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 12 n = 6

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 121×CCDB · Cave1957

CCDB · Cave1957 — de Wet

n 71×CCDB · Cave1963

CCDB · Cave1963 — Pienaar 1963

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.958 ↗

07Deep time~9.35 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin9.35 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type84 records

Wild obs. + sensor30

Museum / vouchered54

Range

Area of Occupancy AOO224 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 18≤1 km 7

25 georeferenced · 5 without coordinates

Open the mapobservation + sensor30

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 54 records without

Open the institutions mapphysical evidence54

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	33
Durban, ZA	16
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	2
Zürich, CH	1
Cape Town, ZA	1
LNBG$location not on record	1

6 institutions · 54 of 54 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Ornithogalum saundersiae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)