Ornithogalum pyrenaicum
speciesAt a glance
Occurrence records21 026
Data sources10
Biological traits45
DNA specimens7
eDNA detections5
Sources10 archives
Databases and archives Ornithogalum pyrenaicum's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility21 026 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics7 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources45 traits
Occurrence & distributionGBIF21 026 records
Environmental DNA1 datasets · 1 countries5 detections
DNA & barcodingBOLD · NCBI7 specimens
Genome at a glanceCCDB13.4 Gbp
01Narrative
L'Ornithogale des Pyrénées, appelé aussi Asperge des bois ou encore Aspergette, est une plante herbacée vivace de la famille des Liliacées selon la classification classique ou des Asparagacées selon la classification phylogénétique APG IV (2016). En 1988, elle a été transférée dans le genre Loncomelos. Ses jeunes tiges sont comestibles d’où les noms « asperge des bois » ou « aspergette ».
No narrative description available for this taxon yet.
02Traits & measurements
SourcesTRYLEDAGIFTAusTraitsWCVP
Size & morphology15
Fruit length max10 mm
Fruit length min8 mm
Leaf length max500 mm
Leaf length min300 mm
Leaf size3 162 mm²
Leaf width7.5 mm
Leaf width max15 mm
Leaf width min5 mm
Plant height0.725 m
Plant height max0.8 m
Plant height min0.25 m
Seed length3.45 mm
Seed mass7.18 mg
⚠ sources differ — TRY: 7.18 mg · LEDA: 5.96 mg · GIFT: 6.81 mg
Seed mass max9.6 mg
Seed mass min6.7 mg
Life cycle & reproduction11
Deciduousnessvernal
⚠ sources differ — TRY: vernal · GIFT: deciduous
Dehiscencedehiscent
Flower colouryellow
Flower length max9 mm
Flower length min6 mm
Flowering endJul
Flowering startJun
Life formbulbous geophyte
Life spanperennial
Raunkiær life formcryptophyte
Seed number60
Diet & foraging1
Parasiteindependent
Habitat & environment12
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max800 m
Elevation min200 m
Epiphyteterrestrial
Fruit typecapsule
Growth formherb
Habitat GIFTcrop fields, meadows, mountains, roadsides, steppe
Leaf formelliptic
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry3
Leaf n53 mg/g
Leaf p4.9 mg/g
Photosynthetic pathwayC3
Other traits3
Diaspore typeseed
Inflorescenceraceme
Plant support typefree-standing
05DNA & barcoding7 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ornithogalum pyrenaicum has left across the world's sequence archives.
At a glance
DNA specimens7
Marker genes4
GenBank sequences7
eDNA detections5
Countries1
The DNA barcodea real sequence read deposited for this species
CCCTGTCGTGCCTTGCGGAAGGAACATTGTCGAGGCCCGAACGGACTATCGCGAACTTGTGAACGCACCCGCGGGGGCGCGGAGCGTGGG …
Ornithogalum pyrenaicum voucher SOA 063693 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL3★ITS2★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Ornithogalum pyrenaicum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size13 398 600 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
THIS GENOME Ornithogalum pyrenaicum13.4 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 16 n = 8
Ploidydiploid inferred
Chromosome records16–642n range16median16mode46records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1633×CCDB · ita-fl · CCDB · iber-fl · CCDB · fl-europaea +6
CCDB · ita-fl — GARBARI F., TORNADORE N. - 1970. Numeri cromosomici per la flora italiana:1-2.. Inform. Bot. Ital. , 2(2): 74-75.
CCDB · ita-fl — CHIAPPINI M. - 1968. Contributo alla conoscenza citotassonomica del genere "Ornithogalum".. Giorn. Bot. Ital. , 102(6): 551-552.
CCDB · ita-fl — CHIAPPINI M., SCRUGLI A. - 1972. Numeri cromosomici per la flora italiana:126.. Inform. Bot. Ital. , 4(2): 131.
CCDB · ita-fl — CHIAPPINI M. - 1972. Contributo alla conoscenza citotassonomica del genere "Ornithogalum".. Morisia , 3: 53-76.
CCDB · ita-fl — TORNADORE N. - 1988 (1987). Il Genere Ornithogalum L. (Liliaceae). in Italia. VIII. Il subgen. beryllis (Salisb.) Baker con particolare riguardo ad o. brevistylum wolfner.. Atti Soc. Tosc. Sci. Nat. Pisa. Mem., ser. B , 94: 341-356.
CCDB · iber-fl — Contribucin al estudio cariolgico del gnero Ornithogalum en Andaluca occidental (Espaa). Pastor, J. & J. C. Diosdado.Acta Bot. Gallica141(1): 49-60(1994).
CCDB · iber-fl — Estudos cariolgicos no gnero Ornithogalum L. Barros Neves, J.Bol. Soc. Brot. ser. 226: 5-192(1952).
CCDB · iber-fl — Etude cytognetique des taxons des sousgenres Beryllis et Cathissa du genre Ornithogalum L. au Maroc... Moret, J.Webbia41(1): 143-153(1987).
CCDB · fl-europaea — Chiappini
CCDB · ipcn-api-dl — Moret, J. 1987. étude cytogénétique des taxons des sous-genre Beryllis et Cathissa du genre Ornithogalum L. au Maroc: discussion des résultats dans le cadre d'une syst@3ematique @3evolutive du genre. Webbia 41: 143–153.
CCDB · ipcn-api-dl — `opova, M. & Ž. Sekovski. 1989. Chromosome atlas of some Macedonian angiosperms. V. God. Zborn. Biol. Prir.-Mat. Fak. Univ. Kiril & Metodij 39–40: 353–365.
CCDB · ipcn-api-dl — Azzioui, O., J. Moret & M. Guern. 1990. Giemsa C-banded karyotypes of some Ornithogalum L. species in North Africa. Cytologia 55: 125–134.
CCDB · ipcn-api-dl — Johnson, M. A. T. & P. E. Brandham. 1997. New chromosome numbers in petaloid monocotyledons and in other miscellaneous angiosperms. Kew Bull. 52(1): 121–138.
CCDB · ipcn-api-dl — Van Loon, J. C. & B. Kieft. 1980. In Chromosome number reports LXVIII. Taxon 29: 538–542.
CCDB · ipcn-api-dl — Pastor, J. & J. C. Diosdado. 1994. Contribución al estudio cariológico del género Ornithogalum en Andalucía occidental (España). Acta Bot. Gall. 141(1): 49–60.
CCDB · ipcn-api-dl — Agapova, N. D. 1985. To the question of Ornithogalum melancholicum (Liliaceae). Bot. Zhurn. SSSR 70(11): 1481–1484.
CCDB · book-ipcn72 — CHIAPPINI, M. & A. SCRUGLI. 1972. In Numeri cromosomici per la flora Italiana. Informatore Bot. Ital:" 4: 128-133.
CCDB · book-ipcn67-71 — GARBARI, F., & N. TORNADORE. 1970. In Numeri cromosomici per la flora Italiana. Informatore Bot.--Ytal. 2: 74-82.
CCDB · book-ipcn75-78 — Agapova 1976
CCDB · book-ipcn75-78 — Agapova 1977
CCDB · book-ipcn75-78 — Loon & Oudemans 1976
CCDB · book-ipcn75-78 — Kieft & Loon 1978
CCDB · book-ipcn73-74 — BARROS NEVES, J. 1973. Contribution a la connaissance cytotaxinomique des Spermatophyta du Portugal. VIII. Liliaceae. Bol. Soc. Brot. 47(Ser. 2}: 157 212.
CCDB · CromoCat 2015 — Barros Neves, J. (1952). Estudos cariológicos no género Ornithogalum L. Bol. Soc. Brot. 26: 5-192.
CCDB · CromoCat 2015 — Barros Neves, J. (1973). Contribution à la connaissance cytotaxonomique des Spermatophyta du Portugal. VIII. Liliaceae. Bol. Soc. Brot. 47: 157-212.
CCDB · CromoCat 2015 — Kieft, B. & van Loon, J. C. (1978). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXII]. Taxon 27(5/6): 524-525.
CCDB · CromoCat 2015 — Loon van, J. C. & Kieft, B. (1980a). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXVIII]. Taxon 29(4): 538-542. si
CCDB · CromoCat 2015 — Loon van, J. C. & Oudemans, J. J. M. H. (1976). Chromosome numbers of some Angiosperms of the southern U.S.S.R. Acta Bot. Neerl. 25: 329-336.
CCDB · CromoCat 2015 — Moret, J. (1987). Etude cytogénetique des taxons des sousgenres Beryllis et Cathissa du genre Ornithogalum L. au Maroc... Webbia 41(1): 143-153.
CCDB · CromoCat 2015 — Pastor Díaz, J. & J. C. Diosdado. (1994). Contribución al estudio cariológico del género Ornithogalum en Andalucía occidental (España). Acta Bot. Gallica 141(1): 49-60.
CCDB · CromoCat 2015 — Wittmann, H. (1985). Beitrag zur systematik der Ornithogalum arten mit verlängert-traubiger infloreszenz. Stapfia 22.
2n 186×CCDB · fl-europaea · CCDB · ipcn-api-dl · CCDB · book-ipcn72 +1
CCDB · fl-europaea — Lungeanu, 1971
CCDB · ipcn-api-dl — Dalgic, G. & N. Özhatay. 1997. The genus Ornithogalum (Liliaceae) and its karyotype variation in European Turkey. Bocconea 5: 743–747.
CCDB · ipcn-api-dl — LUNGEANU, I. 1972. Contributions to the caryologic study of the genus Ornithogalum. Lucr. Grăd. Bot Bucures|7ti 1970–1971: 147–151.
CCDB · book-ipcn72 — LUNGEANU, I . 1972. Contributions to the caryologic study of the genus Ornithogalum. Acta Bot. Horti Bucurestiensis 1970-71: 147-151.
CCDB · book-ipcn67-71 — CULLEN, J., & J. A. RATTER. 1967. Taxonomic and cytological notes on Turkish Ornithogalum. Notes Roy. Bot. Gard. Edinburgh 27: 293 339.
CCDB · book-ipcn67-71 — LUNGEANU, I. 1971. In IOPB chromosome reports XXXIII. Taxon 20: 609-614.
2n 245×CCDB · ipcn-api-dl · CCDB · book-ipcn72 · CCDB · book-ipcn67-71 +1
CCDB · ipcn-api-dl — LUNGEANU, I. 1972. Contributions to the caryologic study of the genus Ornithogalum. Lucr. Grăd. Bot Bucures|7ti 1970–1971: 147–151.
CCDB · book-ipcn72 — LUNGEANU, I . 1972. Contributions to the caryologic study of the genus Ornithogalum. Acta Bot. Horti Bucurestiensis 1970-71: 147-151.
CCDB · book-ipcn67-71 — LUNGEANU, I. 1971. In IOPB chromosome number reports XXXIV. Taxon 20: 785-797.
CCDB · CromoCat 2015 — Lungeanu, I. (1971b). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XXXIV]. Taxon 20(5/6): 792.
CCDB · CromoCat 2015 — Lungeanu, I. (1972a). Contributions to the caryologic study of the genus Ornithogalum. Acta Bot. Horti Bucures (1970-71): 147-151.
2n 321×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Sprumont, G. (1928). Chromosomes et satellites dans quelques espèces d'Ornithogalum. Cellule 38: 271-292.
2n 641×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Sprumont, G. (1928). Chromosomes et satellites dans quelques espèces d'Ornithogalum. Cellule 38: 271-292.
n 84×CCDB · book-ipcn75-78 · CCDB · book-ipcn73-74 · CCDB · CromoCat 2015
CCDB · book-ipcn75-78 — Agapova 1976
CCDB · book-ipcn75-78 — Agapova 1977
CCDB · book-ipcn73-74 — LEUTE, G.-H. 1974. In IOPB chromosome number reports XLVI. Taxon 23: 801-812.
CCDB · CromoCat 2015 — Leute, G. -H. (1974). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XLVI]. Taxon 23(5/6): 811-812.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=0.817 ↗
08Occurrence & distribution
Record type21 026 records
Wild obs. + sensor19 653
Museum / vouchered648
Cultivated / captive17
Other708
Origin
Native810
Introduced88
Range
Area of Occupancy AOO30 600 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy26% within 1 km
≤100 m 2 448≤1 km 1 092≤10 km 9 553>10 km 327
13 420 georeferenced · 6 233 without coordinates
Open the mapobservation + sensor19 653
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy55% within 1 km
≤100 m 16≤1 km 154≤10 km 130>10 km 8
308 georeferenced · 340 without coordinates
Open the institutions mapphysical evidence648
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy15% within 1 km
≤1 km 2≤10 km 11
13 georeferenced · 4 without coordinates
Open the mapnot free-living17
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions35 of 66 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Moscow State Universitylocation not on record | 112 |
| MeiseBGlocation not on record | 62 |
| MAlocation not on record | 58 |
| Entomological Society of Latvialocation not on record | 31 |
| Bern, CH | 28 |
| CICYTEXlocation not on record | 27 |
| Berlin, DE | 24 |
| Barcelona, ES | 21 |
| Vitoria, ES | 21 |
| ISAlocation not on record | 20 |
| BDBClocation not on record | 18 |
| CJBGlocation not on record | 16 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 13 |
| Zürich, CH | 12 |
| Badajoz, ES | 12 |
| València, ES | 12 |
| Salamanca, ES | 9 |
| Madrid, ES | 8 |
| BClocation not on record | 8 |
| South Kensington, GB | 8 |
| Porrentruy, CH | 7 |
| Auckland, NZ | 6 |
| Zürich, CH | 6 |
| OLAlocation not on record | 5 |
| Córdoba, ES | 5 |
| College of the Atlantic, Museumlocation not on record | 5 |
| Wlocation not on record | 5 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 4 |
| BRNUlocation not on record | 4 |
| Alicante, ES | 3 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 3 |
| Wellington, NZ | 3 |
| JBCLMlocation not on record | 3 |
| Pamplona, ES | 3 |
| Oskarshamn, SE | 2 |
| Saint Louis, US | 2 |
| Dresden, DE | 2 |
| LDlocation not on record | 2 |
| Xiamen, CN | 2 |
| Museo Achille Folettolocation not on record | 2 |
| Provincia di Livornolocation not on record | 2 |
| Coimbra, PT | 2 |
| SLU Artdatabankenlocation not on record | 2 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 2 |
| Frankfurt am Main | 2 |
| Durham, US | 1 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 1 |
| Salvador, BR | 1 |
| Namur, BE | 1 |
| Sion, CH | 1 |
| Monastir, TN | 1 |
| GZUlocation not on record | 1 |
| Paris, FR | 1 |
| Banyoles, ES | 1 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| Jaén, ES | 1 |
| National Museum Waleslocation not on record | 1 |
| Christchurch, NZ | 1 |
| Granada, ES | 1 |
| Institute of Botany, Ilia State Universitylocation not on record | 1 |
| SNSNMClocation not on record | 1 |
| Oulu, FI | 1 |
| Edinburgh, GB | 1 |
| Adam Mickiewicz University in Poznańlocation not on record | 1 |
| ULBF-AGRlocation not on record | 1 |
66 institutions · 625 of 648 vouchered records shown · 23 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA5 detections
Where the DNA of Ornithogalum pyrenaicum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found5
Studies independent surveys1
Countries1
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 5 detections have coordinates
Open the map1 country0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median14.7 °C 14.7–14.7
Seasonal swing summer↔winter11.3 °C
Max temp (day)17.4 °C
Min temp (night)11.2 °C
Precipitation68.3 mm/mo
Air humidity61.8 %
Moisture balance-49.7 mm/mo
Vapour deficit635 Pa
Wind speed4.10 m/s
Cloud cover50.6 %
CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.