Ornithogalum arabicum

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Asparagaceae/Ornithogalum

At a glance

Occurrence records664

Data sources7

Biological traits41

DNA specimens7

eDNA detections7

Sources7 archives

Databases and archives Ornithogalum arabicum's data was compiled from.

GBIFGlobal Biodiversity Information Facility664 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

Paleobiology DatabasePBDB consortiumfossil record↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements4 literature sources41 traits

Occurrence & distributionGBIF664 records

Environmental DNA1 datasets · 1 countries7 detections

DNA & barcodingBOLD · NCBI7 specimens

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology14

Fruit length max11 mm

Fruit width max10 mm

Leaf length800 mm

Leaf length max750 mm

Leaf length min350 mm

Leaf width30 mm

Leaf width max50 mm

Leaf width min20 mm

Plant height0.4 m

Plant height max0.8 m

Plant height min0.2 m

Seed length max3.5 mm

Seed length min2.8 mm

Seed mass1.5 mg

Life cycle & reproduction14

Dehiscencedehiscent

Dispersal typeunspecialized

Flower colourwhite

Flower length max25 mm

Flower length min20 mm

Flowering endMay

Flowering startMar

Life formbulbous geophyte

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formcryptophyte

Self fertilizationabsent

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit typecapsule

Growth formherb

Leaf formlinear

Leaf shapelinear

Woodinessnon-woody

Other traits3

Inflorescenceraceme

Plant support typefree-standing

Seeds per fruit1-10

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ornithogalum arabicum has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes4

GenBank sequences5

eDNA detections7

Countries1

The DNA barcodea real sequence read deposited for this species

ITSHQ615084.1 ↗829 bp

ACGT

TGGTCCGGTGAAGTGTTCGGATCGCGGCGACGGGGGCGGTTCGCTGCCCGCGACGTCGGGAGAAGTCCACTGAACCTTATCATTTAGAGG …

Melomphis arabica voucher ABH50134 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL2★ITS1★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type664 records

Wild obs. + sensor511

Museum / vouchered120

Cultivated / captive2

Other31

Origin

Native15

Introduced16

Range

Area of Occupancy AOO1 576 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 170≤1 km 127≤10 km 50>10 km 12

359 georeferenced · 152 without coordinates

Open the mapobservation + sensor511

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy36% within 1 km

≤100 m 12≤1 km 14≤10 km 44>10 km 3

73 georeferenced · 47 without coordinates

Open the institutions mapphysical evidence120

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 32 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Adelaide, AU	21
Kensington, AU	14
BClocation not on record	8
Canberra, AU	6
BDBClocation not on record	6
MAlocation not on record	6
Barcelona, ES	5
València, ES	4
UIBlocation not on record	4
Alicante, ES	4
ISAlocation not on record	4
Wlocation not on record	3
Museo della Bonifica di San Donà di Piavelocation not on record	3
Salamanca, ES	3
Parkville, AU	2
Museo Entomologico de Leonlocation not on record	2
Riverside, US	2
LDlocation not on record	2
JBSlocation not on record	2
Institut und Museum fuer Geologie und Palaeontologielocation not on record	2
CJBGlocation not on record	2
Adam Mickiewicz University in Poznańlocation not on record	2
Mount Annan, AU	1
Berlin, DE	1
ASUlocation not on record	1
Auckland, NZ	1
Wellington, NZ	1
Canadian Department of Agriculturelocation not on record	1
Granada, ES	1
Badajoz, ES	1
Bourges, FR	1
Sevilla, ES	1

32 institutions · 117 of 120 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA7 detections

Where the DNA of Ornithogalum arabicum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.4 °C 15.4–15.4

Seasonal swing summer↔winter15.3 °C

Max temp (day)20.5 °C

Min temp (night)10.4 °C

Precipitation70.4 mm/mo

Air humidity57.7 %

Moisture balance-28.0 mm/mo

Vapour deficit804 Pa

Wind speed2.90 m/s

Cloud cover41.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)