Oreochrysum parryi

(A.Gray) Rydb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Oreochrysum

At a glance

Occurrence records1 005

Data sources11

Biological traits7

DNA specimens1

eDNA detections1

Sources11 archives

Databases and archives Oreochrysum parryi's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 005 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources7 traits

Occurrence & distributionGBIF1 005 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Oreochrysum is a genus of flowering plants in the family Asteraceae.Rydberg, Per Axel. 1906. Bulletin of the Torrey Botanical Club 33(3): 152-153 in EnglishTropicos, Oreochrysum Rydb. SpeciesFlann, C (ed) 2009+ Global Compositae ChecklistThe Plant List Oreochrysum parryi (A.Gray) Rydb. There is only one known species, Oreochrysum parryi, native to western North America (Chihuahua, New Mexico, Arizona, Nevada, Utah, Colorado, Wyoming, South Dakota).Flora of North America Vol. 20 Page 166 Oreochrysum Rydberg, Bull. Torrey Bot. Club. 33: 152. 1906.Biota of North America Program 2013 county distribution mapTropicos, specimen listing, Solidago parryi (A. Gray) Greene Parry's goldenrod is a common name for this species.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Oreochrysum parryi has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences3

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAY170958.1 ↗618 bp

ACGT

TCGAAGCCTGCAAAGCAGAACGACCCGTGAACATGTTACAACAACCATGCCAGGATGGGTCGGACGTCAGTTCGATTCTCGTGGCACACC …

Oreochrysum parryi RR301 internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Oreochrysum parryi carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records18–182n range18median18mode7records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 187×CCDB · ipcn-api-dl · CCDB · eflora

CCDB · ipcn-api-dl — Semple, J. C. 1985. Chromosome number determinations in fam. Compositae tribe Astereae. Rhodora 87: 517–527.

CCDB · ipcn-api-dl — Semple, J. C. & J. G. Chmielewski. 1987. Chromosome number determinations in fam. Compositae, tribe Astereae. II. Additional counts. Rhodora 89: 319–325.

CCDB · ipcn-api-dl — Semple, J. C., G. S. Ringius, C. Leeder & G. Morton. 1984. Chromosome numbers of goldenrods, Euthamia and Solidago (Compositae: Astereae). II. Additional counts with comments on cytogeography. Brittonia 36(3): 280–292 [erratum 37: 121].

CCDB · ipcn-api-dl — Semple, J. C., J. G. Chmielewski & M. E. Lane. 1989. Chromosome number determinations in fam. Compositae, tribe Astereae. III. Additional counts and comments on generic limits and ancestral base numbers. Rhodora 91: 296–314.

CCDB · ipcn-api-dl — Semple, J. C., J. G. Chmielewski & C. Xiang. 1992. Chromosome number determinations in fam. Compositae, tribe Astereae. IV. Additional reports and comments on the cytogeography and status of some species of Aster and Solidago. Rhodora 94: 48–62.

CCDB · ipcn-api-dl — Semple, J. C., C. Xiang, J. Zhang, M. Horsburgh & R. Cook. 2001. Chromosme number determinations in Fam. Compositae, tribe Astereae. VI. Western North American taxa and comments on generic treatments of North American asters. Rhodora 103: 202–218.

CCDB · eflora

n 95×CCDB · ipcn-api-dl · CCDB · book-ipcn73-74

CCDB · ipcn-api-dl — Ward, D. E. & R. W. Spellenberg. 1986. Chromosome counts of angiosperms of western North America. Phytologia 61: 119–125.

CCDB · ipcn-api-dl — Ward, D. E. & R. Spellenberg. 1988. Chromosome counts of angiosperms from New Mexico and adjacent areas. Phytologia 64: 390–398.

CCDB · ipcn-api-dl — Keil, D. J. 1979. In IOPB chromosome number reports LXIII. Taxon 28: 271–273.

CCDB · ipcn-api-dl — Hartman, R. L. 1977. In IOPB chromosome number reports LVI. Taxon 26: 257–274.

CCDB · book-ipcn73-74 — ANDERSON, L.C., D.W. KYHOS, T. MOSQUIN, A.M. POWEL~, & P.H. RAVEN. 1974. Chromosome numbers in Compositae. IX Haplopappus and other Astereae. Amer. J. Bot. 61: 665-671.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 005 records

Wild obs. + sensor376

Museum / vouchered629

Origin

Native3

Range

Area of Occupancy AOO2 952 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 212≤1 km 25≤10 km 12>10 km 12

261 georeferenced · 115 without coordinates

Open the mapobservation + sensor376

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy64% within 1 km

≤100 m 48≤1 km 163≤10 km 108>10 km 12

331 georeferenced · 298 without coordinates

Open the institutions mapphysical evidence629

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions33 of 46 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DOI/NPS, Colonial National Historical Parklocation not on record	118
Albuquerque, US	93
Musee des Dinosaures d'Esperaza (Aude)location not on record	58
Denver, US	47
Flagstaff, US	47
ASUlocation not on record	32
Wuzhou, CN	26
Durango, US	22
Riverside, US	21
Saint Louis, US	20
Bronx, US	19
Rocky Mountain Biological Laboratorylocation not on record	17
EL PASO, US	16
Phoenix, US	11
Provo, US	8
San Luis Obispo, US	7
Logan, US	6
DOI/NPS, Greenbelt Parklocation not on record	6
Orem, US	5
Pocatello, US	4
Pittsburg, US	4
University of Stellenboschlocation not on record	4
US	3
WTUlocation not on record	3
Tempe, US	3
Chongqing Museumlocation not on record	3
New Mexico Museum of Natural History and Sciencelocation not on record	2
Montréal, CA	2
Chadron, US	2
San Angelo, US	2
Pullman, US	2
Taipei, TW	2
Laboratorio de Ictiologialocation not on record	1
Wlocation not on record	1
Moscow, US	1
US	1
Clemson, US	1
Durham, US	1
Chapel Hill, US	1
Moscow State Universitylocation not on record	1
Kew, GB	1
Guasave, MX	1
USFSlocation not on record	1
Dekalb, US	1
Davis, US	1
Bloomington, US	1

46 institutions · 629 of 629 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Oreochrysum parryi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Oreochrysum parryi

At a glance

Sources11 archives

Life cycle & reproduction1

Diet & foraging1

Habitat & environment5

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 005 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions33 of 46 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type1 005 records