Oreochloa disticha

(Wulfen) Link · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Oreochloa

At a glance

Occurrence records5 454

Data sources9

Biological traits30

DNA specimens3

eDNA detections3

Sources9 archives

Databases and archives Oreochloa disticha's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 454 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources30 traits

Occurrence & distributionGBIF5 454 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 14

01Narrative

Das Zweizeilige Blaugras (Oreochloa disticha), auch Zweizeiliges Kopfgras genannt, ist eine Pflanzenart innerhalb der Familie der Süßgräser (Poaceae).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTLEDATRYWCVP

Size & morphology7

Leaf size37.35 mm²

Plant height0.115 m

⚠ sources differ — GIFT: 0.115 m · LEDA: 0.115 m · TRY: 0.086 m

Plant height generative0.15 m

Plant height max0.2 m

Plant height min0.1 m

Seed length3.92 mm

Seed mass0.641 mg

Life cycle & reproduction7

Deciduousnessaestival

⚠ sources differ — TRY: aestival · GIFT: deciduous

Dispersal typewind

Flowering endAug

Flowering startJul

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

⚠ sources differ — GIFT: herb · TRY: graminoid

Mycorrhiza type0.00000000101

Woodinessnon-woody

Physiology & chemistry7

Leaf C:N ratio21.72 g/g

Leaf c462 mg/g

Leaf dry-matter content (LDMC)411 mg/g

Leaf n20.3 mg/g

Leaf p1.64 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)7.06 mm²/mg

⚠ sources differ — TRY: 7.06 mm²/mg · LEDA: 9.2 mm²/mg · GIFT: 9.2 mm²/mg

Other traits1

Diaspore typefruit with appendage

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Oreochloa disticha has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes2

GenBank sequences6

eDNA detections3

Countries2

The DNA barcodea real sequence read deposited for this species

ITSDQ539588.1 ↗413 bp

ACGT

ACCCTGACCAAAACAGACCGCGCACGCGTCATCTACCCCGCCGAGCGGCGGATCCGTCCGTCGCTCGGCCAAGTCCTCGACAACCTCCTC …

Oreochloa disticha 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★ITS4

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Oreochloa disticha carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Ploidypolyploid inferred

Chromosome records14–142n range14median14mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 145×CCDB · slov-fl · CCDB · fl-europaea · CCDB · poland +2

CCDB · slov-fl — Májovský J. et al., 1976: Index of chromosome numbers of Slovakian flora (Part 5). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 25: 1-18.

CCDB · fl-europaea — Reese, 1953

CCDB · poland — Bielecki E. 1955. Cyto-taxonomical studies in Oreochloa disticha Link, Sesleria uliginosa Opiz. and S. calcaria Opiz. Acta Soc. Bot. Pol. 24, 145-162.

CCDB · book-fedorov — Reese 1953

CCDB · book-atlas-flowering-plants — Reese 1953

n 72×CCDB · book-ipcn73-74 · CCDB · CromoCat 2015

CCDB · book-ipcn73-74 — KUPFER, P. 1974. Recherches sur les liens de parente entre la flore orophile des Alpes et celle des Pyrenees. Boissiera 23: 1-322.

CCDB · CromoCat 2015 — Küpfer, P. (1974). Recherches sur les liens de parenté entre la flore orophile des Alpes et celle des Pyrénées. Boissiera 23: 3- 322.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type5 454 records

Wild obs. + sensor3 389

Museum / vouchered575

Other1 490

Range

Area of Occupancy AOO4 012 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy32% within 1 km

≤100 m 616≤1 km 123≤10 km 1 568>10 km 17

2 324 georeferenced · 1 065 without coordinates

Open the mapobservation + sensor3 389

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy31% within 1 km

≤100 m 24≤1 km 110≤10 km 292>10 km 1

427 georeferenced · 148 without coordinates

Open the institutions mapphysical evidence575

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions20 of 42 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Uniwersytet Wrocławskilocation not on record	170
Salzburg, AT	134
Zürich, CH	21
LDlocation not on record	19
Bern, CH	19
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	19
Mlocation not on record	15
Dresden, DE	13
GJOlocation not on record	13
Provincia di Livornolocation not on record	13
Adam Mickiewicz University in Poznańlocation not on record	12
Zürich, CH	12
SZUlocation not on record	11
Wlocation not on record	11
BFLlocation not on record	9
Glarus, CH	8
Oskarshamn, SE	8
GZUlocation not on record	8
Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record	6
Frankfurt am Main	6
Moscow State Universitylocation not on record	5
Institut und Museum fuer Geologie und Palaeontologielocation not on record	4
BClocation not on record	3
Barcelona, ES	3
BRNUlocation not on record	3
Auckland, NZ	3
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	2
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	2
Sion, CH	1
Görlitz, DE	1
Fribourg, CH	1
MAlocation not on record	1
PRClocation not on record	1
BIO-UNIPIlocation not on record	1
Porrentruy, CH	1
Helsinki, FI	1
Saint Louis, US	1
CJBGlocation not on record	1
Podgorica, ME	1
València, ES	1
Bourges, FR	1
Salamanca, ES	1

42 institutions · 566 of 575 vouchered records shown · 8 without an institution code

09Environmental DNA3 detections

Where the DNA of Oreochloa disticha was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Oreochloa disticha

At a glance

Sources9 archives

Size & morphology7

Life cycle & reproduction7

Diet & foraging1

Habitat & environment7

Physiology & chemistry7

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type5 454 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions20 of 42 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type5 454 records