Opogona omoscopa

(Meyrick, 1893) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tineidae/Opogona

At a glance

Occurrence records2 663

Data sources7

Biological traits0

DNA specimens629

eDNA detections668

Sources7 archives

Databases and archives Opogona omoscopa's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 663 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI668 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics629 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 663 records

Environmental DNA2 datasets · 11 countries668 detections

DNA & barcodingBOLD629 specimens

01Narrative

Opogona omoscopa is a moth of the family Tineidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding629 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Opogona omoscopa has left across the world's sequence archives.

At a glance

DNA specimens629

BINs1

Marker genes1

eDNA detections668

Countries11

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P653 bp consensus607 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

10Cmostly conserved

175Tmostly conserved

217Avariable

538Amostly conserved

ATTATACTTCATTTTAGGTATTTGAGCAGGATTAGTAGGTACATCTTTAAGAATTTTAATTCGAATAGAATTAGGTAACCCTGGCTCTAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.24%

Haplotypes12

BIN1

Most divergent pair0.77%

AfricaOceaniaN.AmericaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Opogona saccharisame genus10.1%Opogona minutissimasame genus11.3%Opogona arizonensissame genus11.6%Opogona subaeneellasame genus11.6%Opogona comptellasame genus11.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 663 records

Wild obs. + sensor2 521

Museum / vouchered141

Other1

Origin

Introduced1

Range

Area of Occupancy AOO3 604 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 956≤1 km 641≤10 km 144>10 km 187

1 928 georeferenced · 593 without coordinates

Open the mapobservation + sensor2 521

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 15≤1 km 8≤10 km 18>10 km 5

46 georeferenced · 95 without coordinates

Open the institutions mapphysical evidence141

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Auckland, NZ	25
Washington, US	22
New Haven, US	21
Mississippi State, US	16
Denver, US	7
MWLRlocation not on record	6
Santa Cruz, US	4
San Francisco, US	3
San Diego, US	3
New Zealand Arthropod Collectionlocation not on record	3
Essig Museum of Entomologylocation not on record	3
Smithsonian Institution, National Museum of Natural Historylocation not on record	2
DanishLepidopterologicalSocietylocation not on record	2
University of California, Davislocation not on record	2
NHMOlocation not on record	2
Australian National Insect Collectionlocation not on record	2
DPIlocation not on record	2
UAclocation not on record	1
Cape Town, ZA	1
Stockholm, SE	1
SLU Artdatabankenlocation not on record	1
Natural History Museum, Londonlocation not on record	1

22 institutions · 130 of 141 vouchered records shown · 11 without an institution code

09Environmental DNA668 detections

Where the DNA of Opogona omoscopa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found668

Studies independent surveys2

Countries11

Verifiable raw sequence linked3

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 668 detections have coordinates

Open the map11 countries0

4. Native Grassland|4.6. Subtropical/Tropica…Mixed habitatPines5. Wetlands (inland) | 5.16. Permanent Salin…MangrovesForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.8 °C 12.5–22.8

Seasonal swing summer↔winter9.80 °C

Max temp (day)23.2 °C 17.6–27.9

Min temp (night)13.2 °C 8.00–17.2

Precipitation86.9 mm/mo 17.1–134

Air humidity60.0 % 48.0–64.4

Moisture balance-44.7 mm/mo -104–27.6

Vapour deficit882 Pa 620–1,220

Wind speed2.90 m/s 1.60–4.50

Cloud cover29.4 % 9.50–38.9

CHELSA 1981–2010, ~9 km grid, at location & month of 631 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Opogona omoscopa

At a glance

Sources7 archives

At a glance

Record type2 663 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 22 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 663 records