Ophisternon bengalense

McClelland, 1844 · species

image placeholder — illustration coming later

Animalia/Chordata/Synbranchiformes/Synbranchidae/Ophisternon

At a glance

Occurrence records177

Data sources9

Biological traits6

DNA specimens7

eDNA detections2

Sources9 archives

Databases and archives Ophisternon bengalense's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility67 records↗

OBISOcean Biodiversity Information System110 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF · OBIS177 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD7 specimens

01Narrative

Ophisternon bengalense the Bengal eel, Bengal mudeel or onegill eel, is a species of fish in the family Synbranchidae. It is endemic to freshwater and brackish water rivers and swamps in Oceania and South Asia. It is normally 100 cm in maximum length.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length100 cm

Habitat & environment3

Habitat brackishyes

Habitat freshwateryes

Habitat zonedemersal

Uses & economy1

Commercial importanceof no interest

Other traits1

Vulnerability60

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ophisternon bengalense has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes1

eDNA detections2

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P678 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.19%

Haplotypes2

BIN1

Most divergent pair0.29%

Where individuals differ — all 2 variable positions, in barcode order

42Cvariable

123Cvariable

GACATTGGCACCCTTTATTTAGTATTTGGTGCTTGAGCTGGCATAGTCGGAACAGCCCTAAGTCTTTTAATTCGAGCAGAGCTATGTCAA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ophisternon aenigmaticumsame genus16.7%Mastacembelus simbisame order17.7%Mastacembelus cunningtonisame order17.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type177 records

Wild obs. + sensor13

Museum / vouchered161

Other3

Range

Area of Occupancy AOO300 km²

Depth

0–200 m sunlit1

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 0.3 m · max 0.3 m · 1 record with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy25% within 1 km

≤100 m 1≤10 km 1>10 km 2

4 georeferenced · 9 without coordinates

Open the mapobservation + sensor13

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 2≤1 km 26≤10 km 15>10 km 13

56 georeferenced · 105 without coordinates

Open the institutions mapphysical evidence161

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Natick, US	22
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	12
CASlocation not on record	7
Toronto, CA	2
	2
Western Australian Museumlocation not on record	2
Paris, FR	2
Museum and Art Gallery of the Northern Territorylocation not on record	2
Sydney, AU	1
Kagoshima University Museumlocation not on record	1
Stockholm, SE	1
FishBaselocation not on record	1

12 institutions · 55 of 161 vouchered records shown · 4 without an institution code

09Environmental DNA2 detections

Where the DNA of Ophisternon bengalense was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)