Ophiocordyceps dipterigena

Fungi/Ascomycota/Sordariomycetes/Hypocreales/Ophiocordycipitaceae/Ophiocordyceps

At a glance

Occurrence records36

Data sources5

Biological traits0

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Ophiocordyceps dipterigena's data was compiled from.

GBIFGlobal Biodiversity Information Facility36 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Chemical compositionLOTUS2 compounds

Occurrence & distributionGBIF36 records

DNA & barcodingNCBIsequences

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition2 compounds

Compounds documented for Ophiocordyceps dipterigena across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Depsidones2

Documented compounds2 total

Compound	Class	Amount	Source
Cordycepsidone A		present	LOTUS
Cordycepsidone B		present	LOTUS

05DNA & barcoding4 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ophiocordyceps dipterigena has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences4

The DNA barcodea real sequence read deposited for this species

ITSGU723764.1 ↗458 bp

ACGT

GTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACAGTGGTTTACACACATCCTTTGTGAACTTTTTGTTGCCTTGGCGA …

Ophiocordyceps dipterigena strain MY621 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS4

fungal barcode

08Occurrence & distribution

Record type36 records

Wild obs. + sensor16

Museum / vouchered20

Range

Area of Occupancy AOO96 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy14% within 1 km

≤1 km 1≤10 km 4>10 km 2

7 georeferenced · 9 without coordinates

Open the mapobservation + sensor16

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 19 without coordinates

Open the institutions mapphysical evidence20

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Blumenau, BR	14
UFSClocation not on record	4
Kew, GB	1
Catholic University of Pekinglocation not on record	1

4 institutions · 20 of 20 vouchered records shown