Opharus subflavus

de Toulgoët, 1981 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Opharus

At a glance

Occurrence records108

Data sources7

Biological traits0

DNA specimens4

eDNA detections4

Sources7 archives

Databases and archives Opharus subflavus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility108 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF108 records

Environmental DNA1 datasets · 2 countries4 detections

DNA & barcodingBOLD4 specimens

01Narrative

Opharus subflavus is a moth of the family Erebidae. It was described by Hervé de Toulgoët in 1981. It is found in Ecuador.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Opharus subflavus has left across the world's sequence archives.

At a glance

DNA specimens4

BINs1

Marker genes1

eDNA detections4

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.46%

Haplotypes1

BIN1

Where individuals differ — all 6 variable positions, in barcode order

46Tmostly conserved

220Cmostly conserved

368Amostly conserved

442Cmostly conserved

562Gmostly conserved

634Tmostly conserved

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACTTCATTAAGATTATTAATTCGAGCTGAATTAGGAAATCCTGGTTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Pachydota albicepssame family4.3%Leucanopsis guascanasame family4.4%Aemilia brunneiparssame family4.4%Leucanopsis mandussame family4.6%Elysius bicolorsame family4.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type108 records

Wild obs. + sensor108

Range

Area of Occupancy AOO52 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 62≤1 km 23≤10 km 3>10 km 3

91 georeferenced · 17 without coordinates

Open the mapobservation + sensor108

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

09Environmental DNA4 detections

Where the DNA of Opharus subflavus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.4 °C 14.4–15.7

Seasonal swing summer↔winter1.80 °C

Max temp (day)18.2 °C 18.2–20.0

Min temp (night)10.6 °C 10.6–12.1

Precipitation325 mm/mo 293–325

Air humidity71.2 % 70.0–71.2

Moisture balance205 mm/mo 163–205

Vapour deficit470 Pa 470–536

Wind speed1.50 m/s 1.00–1.50

Cloud cover44.2 % 44.2–53.2

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)