Onykia carriboea

Lesueur, 1821 · species

image placeholder — illustration coming later

Animalia/Mollusca/Cephalopoda/Oegopsida/Onychoteuthidae/Onykia

At a glance

Occurrence records184

Data sources10

Biological traits5

DNA specimens9

eDNA detections2

Sources10 archives

Databases and archives Onykia carriboea's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility82 records↗

OBISOcean Biodiversity Information System102 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources5 traits

Occurrence & distributionGBIF · OBIS184 records

Environmental DNA2 datasets · 1 countries2 detections

DNA & barcodingBOLD9 specimens

01Narrative

Onykia carriboea, the tropical clubhook squid, is a squid in the family Onychoteuthidae, the type species of the genus Onykia. It is known with certainty only from immature specimens. The type locality of O. carriboea is the Gulf of Mexico. Onykia robsoni has been suggested as a junior synonym, owing to similarities between the species.Tree of Life web project: Onykia carriboea

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length10 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonepelagic

Other traits2

Depth max200 m

Depth min1 m

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Onykia carriboea has left across the world's sequence archives.

At a glance

DNA specimens9

BINs2

Marker genes3

eDNA detections2

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.38%

Haplotypes1

BIN1

Where individuals differ — all 5 variable positions, in barcode order

76Gmostly conserved

181Gmostly conserved

211Amostly conserved

340Tmostly conserved

628Gmostly conserved

CACATTATACTTTATCTTTGGCATTTGAGCAGGGTTGTTAGGAACCTCTCTAAGCCTAATAATTCGTACTGAACTGGGACAACCAGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Onykia loennbergiisame genus11.9%Moroteuthopsis ingenssame family12.3%Moroteuthopsis longimanasame family12.5%Onykia robustasame genus12.5%Bathyteuthis abyssicolasame order15.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P16S18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type184 records

Wild obs. + sensor37

Museum / vouchered146

Other1

Range

Area of Occupancy AOO452 km²

Depth

0–200 m sunlit33

200–1000 m twilight16

1–4 km midnight1

>4 km abyssal0

median 100.5 m · max 3 162 m · 50 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 36 without coordinates

Open the mapobservation + sensor37

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 146 records without

Open the institutions mapphysical evidence146

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	39
The Atlantic reference Centrelocation not on record	22
Santa Barbara Museum of Natural Historylocation not on record	3
Wellington, NZ	3
Saint John, CA	2
UAclocation not on record	1
UM-RSMASlocation not on record	1

7 institutions · 71 of 146 vouchered records shown · 8 without an institution code

09Environmental DNA2 detections

Where the DNA of Onykia carriboea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys2

Countries1

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.0 °C 22.0–22.0

Seasonal swing summer↔winter7.20 °C

Max temp (day)22.6 °C

Min temp (night)21.5 °C

Precipitation47.2 mm/mo

Air humidity62.7 %

Vapour deficit985 Pa

Cloud cover42.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)