Ononis spinosa
speciesAt a glance
Occurrence records115 224
Data sources14
Biological traits54
DNA specimens32
eDNA detections52
Sources14 archives
Databases and archives Ononis spinosa's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility115 224 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI52 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics32 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources54 traits
Chemical compositionLOTUS · NPASS269 compounds
Occurrence & distributionGBIF115 224 records
Environmental DNA1 datasets · 15 countries52 detections
DNA & barcodingBOLD · NCBI32 specimens
Genome at a glanceCCDB · GoaT1.4 Gbp
01Narrative
La Bugrane épineuse est une espèce de plantes à fleurs du genre Ononis et de la famille des Fabaceae, également connue sous le nom de « Arrête-bœuf ». Elle est utilisée en phytothérapie, principalement pour des affections des reins et de la vessie.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology15
Fruit length8 mm
⚠ sources differ — AusTraits: 8 mm · GIFT: 7 mm
Leaf length10 mm
Leaf length max20 mm
Leaf size321 mm²
⚠ sources differ — TRY: 321 mm² · GIFT: 97.33 mm²
Leaf width6 mm
Plant height0.367 m
⚠ sources differ — GIFT: 0.367 m · AusTraits: 0.45 m · LEDA: 0.275 m · TRY: 0.325 m
Plant height generative0.21 m
Plant height max0.8 m
Plant height min0.1 m
Seed length2.37 mm
⚠ sources differ — TRY: 2.37 mm · AusTraits: 2 mm · GIFT: 2.5 mm
Seed length max2.5 mm
Seed length min2.5 mm
Seed mass4.92 mg
⚠ sources differ — TRY: 4.92 mg · LEDA: 5.34 mg · GIFT: 4.82 mg
Seed mass max6.32 mg
Seed mass min2.26 mg
Life cycle & reproduction14
Deciduousnessaestival
⚠ sources differ — TRY: aestival · GIFT: deciduous
Dehiscencedehiscent
Dispersal typeself
Flowering endSep
Flowering startJun
Life formsubshrub or shrub
Life spanperennial
Lifespan years7.5 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
⚠ sources differ — LEDA: Hemicryptophyte · GIFT: chamaephyte
Reproduction asexualabsent
Seed number152
Self fertilizationabsent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment12
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typelegume
⚠ sources differ — AusTraits: legume · GIFT: capsule
Growth formshrub
⚠ sources differ — GIFT: shrub · AusTraits: shrub · TRY: H
Habitat GIFTcrop fields, mountains, rivers, roadsides, stony places
Leaf compoundnesscompound
Leaf shapeoblong ovate
Mycorrhiza typearbuscular
Woodinesssemi-woody
⚠ sources differ — TRY: semi-woody · AusTraits: woody · LEDA: semi-woody · GIFT: non-woody
Physiology & chemistry10
Leaf C:N ratio11.6 g/g
Leaf c475 mg/g
Leaf dry-matter content (LDMC)283 mg/g
Leaf n43.78 mg/g
Leaf p1.94 mg/g
Nitrogen fixingnitrogen_fixer
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)22.71 mm²/mg
⚠ sources differ — TRY: 22.71 mm²/mg · LEDA: 28.41 mm²/mg · GIFT: 25.81 mm²/mg
Wood density203 mg/cm³
Other traits1
Diaspore typeone-seeded generative dispersule
03Chemical composition269 compounds
Compounds documented for Ononis spinosa across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Abietane diterpenoids42
Labdane diterpenoids19
Eudesmane sesquiterpenoids18
Labdane diterpenoids $ Norlabdane diterpenoids18
Flavones15
Documented compounds269 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-1(10),4-Cadinadiene | present | NPASS | |
| (+)-alpha-Pinene | present | NPASS | |
| (+)-Copalol | present | NPASS | |
| (+)-Delta-cadinol | present | NPASS | |
| (+)-gamma-Eudesmol | present | NPASS | |
| (+)-Isocupressic acid | present | NPASS | |
| (+)-Isomenthone | present | NPASS | |
| (+)-Onocerin | present | LOTUS | |
| (+)-taxifolin | present | NPASS | |
| (+)-Totarol | present | NPASS |
05DNA & barcoding32 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ononis spinosa has left across the world's sequence archives.
At a glance
DNA specimens32
Marker genes8
GenBank sequences10
eDNA detections52
Countries15
The DNA barcodea real sequence read deposited for this species
GTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGATGCCATTAGGTTGAGGGCACGTCTGCCTGGGTGTCACATATCGAAGCCTCCTG …
Ononis spinosa subsp. spinosa voucher PLT.0390 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★rbcL1★rbcLa★trnL-F★ITS9★ITS1★ITS2cp-trnL-intron
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT
The complete instruction manual Ononis spinosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size1 398 540 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Ononis spinosa1.4 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 30 n = 15
Ploidydiploid inferred
Chromosome records18–642n range32median30mode94records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 3036×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · ita-fl · CCDB · slov-fl +8
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · ita-fl — GADELLA T.W.J., KLIPHUIS E. - 1970. Cytotaxonomic investigations in some Angiosperms collected in the valley of Aosta and in the National Park Gran Paradiso.. Caryologia , 23(3): 363-379.
CCDB · slov-fl — Kochjarová J., 1992: Karyological study of the Slovak flora XXVIII. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 39: 67-74.
CCDB · brit-fl — Morton, J.K. Watsonia 3: 307-316 (1956)
CCDB · brit-fl — Morisset, P. Watsonia 12: 145-153 (1978)
CCDB · brit-fl — Morisset, P. Bot. Soc. Brit. Isles Proc. 5: 378-379 (1964)
CCDB · brit-fl — Wentworth, J.E., Bailey, J.P., Gornall, R.J. Watsonia 18: 415-418 (1991)
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=2933
CCDB · fl-europaea — Morisset,1964
CCDB · fl-europaea — Larsen, 1956a
CCDB · poland — Skali?ska M., Jankun A., Wcis?o H. et al. 1976. Further studies in chromosome numbers of Polish Angiosperms. Eleventh contribution. Acta Biol. Cracov. Ser. Bot. 19, 107-148.
CCDB · ipcn-api-dl — Semerenko, L. V. & I. V. Shvets. 1989. Karyologicheskoe isuchenie bobovykh (Fabaceae) Belorussii. Pp. 66--68 in Tesizy II Symp. Plant Karyology.
CCDB · ipcn-api-dl — Bijok, K., T. Sulma & H. Tokarz. 1980. Karyological investigations on three species of the genus Ononis L. Zesz. Nauk. Wydz. Biol. Nauk Ziemi, Biol. 2: 69–75.
CCDB · ipcn-api-dl — Morisset, P. 1978. Chromosome numbers in Ononis L. series Vulgares Sirj. Watsonia 12: 145–153.
CCDB · ipcn-api-dl — Skalinska, M., H. JANKUN, H. Wcislo & e. al. 1976. Further studies in chromosome numbers of Polish angiosperms. XI. Acta Biol. Cracov., Ser. Bot. 19: 107–148.
CCDB · ipcn-api-dl — Pavlova, D. & A. Tosheva. 2000. Mediterranean chromosome number reports 10 (1208--1212). Fl. Medit. 10: 419–423.
CCDB · ipcn-api-dl — Natarajan, G. 1977. Contribution à l'etude caryosystematique des especes de la garrigue languedocienne. These, Academie de Montpellier, France.
CCDB · ipcn-api-dl — Natarajan, G. 1978. In IOPB chromosome number reports LXII. Taxon 27: 519–535.
CCDB · ipcn-api-dl — Baltisberger, M. 1987. Chromosomenzahlen einiger Pflanzen aus Albanien. Ber. Geobot. Inst. ETH Stiftung Rübel 53: 47–63.
CCDB · ipcn-api-dl — Wentworth, J. E., J. P. Bailey & R. J. Gornall. 1991. Contributions to a cytological catalogue of the British and Irish flora, 1. Watsonia 18: 415–417.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · book-ipcn67-71 — GADELLA, TH. W.J., E. KLIPHUIS, & K.U. KRAMER. 1970. Zytotaxonomische Untersuchungen an Blutenpflanzen aus dem Osten Osterreichs. Wiss. Arbeiten Burgenland 44: 187-195.
CCDB · book-ipcn67-71 — GADELLA, TH. W.J., & E. KLIPHUIS. 1970. Cytotaxonomic investigations in some angiosperms collected in the Valley of Aosta and in the National Park "Gran Paradiso". Carylogia 23: 363-379.
CCDB · book-ipcn67-71 — GADELLA, T.W.J., & E. KLIPHUIS. 1971. Chromosome numbers of flowering plants in the Netherlands v. Proc. Kon. Ned. Acad. Wetensch. ser C 74:
CCDB · book-ipcn75-78 — Skalinska et al. 1976
CCDB · book-ipcn75-78 — Moris set 1978
CCDB · CromoCat 2015 — Gadella, Th. W. J., Kliphuis, E. & Kramer, K. U. (1970). Zytotaxonomische untersuchungen an blutenpflanzen aus dem Osten Osterreichs. Wiss. Arbeiten Burgenland 44: 187-195.
CCDB · CromoCat 2015 — Morisset P. (1978). Chromosome numbers in Ononis L. series Vulgares Širj. Watsonia 12: 145-153
CCDB · CromoCat 2015 — Sañudo, A., M. Ruíz Rejón & A. Pretel. (1979). Variabilité chromosomique chez les especes d'Ononis de la flore espagnole. Note préliminaire. Webbia 34(1): 535-542.
CCDB · CromoCat 2015 — Castroviejo & al. (2003). Flora Iberica (vol. I-VIII, X, XIV) Publicaciones del CSIC Madrid
2n 3228×CCDB · ita-fl · CCDB · slov-fl · CCDB · iber-fl +8
CCDB · ita-fl — LOEVE A., LOEVE D. - 1982. IOPB chromosome number reports LXXVI.. Taxon , 31(3): 583-587.
CCDB · slov-fl — Májovský J. et al., 1970a: Index of chromosome numbers of Slovakian flora (Part 1). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 16: 1-26.
CCDB · slov-fl — Májovský J. et al., 1976: Index of chromosome numbers of Slovakian flora (Part 5). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 25: 1-18.
CCDB · slov-fl — Hallonová A., 1982: Floristické pomery horskej skupiny Skalky (Strážovské vrchy). - Stredné Slovensko 2: 308-323.
CCDB · iber-fl — IOPB. Chromosome number reports. LI. Saudo, A., A. Pretel & M. Ruz Rejn.Taxon25(1): 163-164(1976).
CCDB · iber-fl — Variabilit chromosomique chez les especes d'Ononis de la flore espagnole. Note prliminaire. Saudo, A., M. Ruz Rejn & A. Pretel.Webbia34(1): 535-542(1979).
CCDB · iber-fl — Chromosome atlas of flowering plants. Darlintong, C. D. & A. P. Wylie.*(1955).
CCDB · mediterranean
CCDB · ipcn-api-dl — Magulaev, A. J. 1980. Chromosome numbers of some Fabaceae in the North Caucasus. Bot. Zhurn. 65 (6): 836–843.
CCDB · ipcn-api-dl — Murin, A. & V. Ferakova. 1976. In Index of chromosome numbers of Slovakian flora. Part 5. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 25: 1–18.
CCDB · ipcn-api-dl — Nazarova. 2004. Pages 1--171 in Chromosome Numbers of Flowering Plants of Armenian Flora. Yerevan.
CCDB · ipcn-api-dl — Pavlova, D. & A. Tosheva. 2002. Mediterranean chromosome number reports 12 (1284--1287). Fl. Medit. 12: 450–454.
CCDB · ipcn-api-dl — SANUDO, A., M. R. Rejon & A. Pretel. 1979. Variabilite chromosomique chez les especes d'Ononis de la Flora Espagnole. Note preliminaire. Webbia 34: 535–542.
CCDB · ipcn-api-dl — PALAZUELES, S., A. P. MARTINEZ & M. R. Rejon. 1976. In IOPB chromosome number reports LI. Taxon 25: 155–164.
CCDB · ipcn-api-dl — Kiehn, M., E. Vitek, E. Hellmayr, J. Walter, J. Tschenett, C. Justin & M. Mann. 1991. Beiträge zur Flora von Österreich: Chromosomenzählungen. Verh. Zool.-Bot. Ges. Wien 128: 19–39.
CCDB · ipcn-api-dl — Dvorak, F., F. Grull, I. Ruzicka & B. Dadakova. 1979. In IOPB chromosome number ! reports LXIV. Taxon 28: 391–392.
CCDB · book-ipcn67-71 — GADELLA, Th. W. J., & E. KLIPHUIS. 1966.' Chromosome numbers of flowering plants in the Netherlands II. Proc. Roy. Neth. Acad. Sci. Ser. C. 69: 541-556.
CCDB · book-ipcn75-78 — Murin & Ferakova 1976
CCDB · book-northern-plants — Tschechow 1933.
CCDB · book-indian_vol1 — Laane, M.M. 1969a
CCDB · book-indian_vol1 — Tischler, G. 1934
CCDB · book-atlas-flowering-plants — Tschechow 1933
CCDB · book-atlas-flowering-plants — Reese" 1952a
CCDB · CromoCat 2015 — Löve, A. & Löve, D. (1982c). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXVI]. Taxon 31(3): 583-587.
CCDB · CromoCat 2015 — Morisset P. (1978). Chromosome numbers in Ononis L. series Vulgares Širj. Watsonia 12: 145-153
CCDB · CromoCat 2015 — Kiehn, M., Vitek, E., Hellmayr, E. & al. (1991). Beiträge zur Flora von Österreich: Chromosomenzählungen Verh. Zool.- Bot. Ges. Österreich 128:19-39
CCDB · CromoCat 2015 — Dvorák, F., Grüll, F., Ruzicka, J. & Dadáková, B. (1979). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXIV]. Taxon 28(4): 391-392.
2n 6020×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · ita-fl · CCDB · brit-fl +6
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · ita-fl — GADELLA T.W.J., KLIPHUIS E. - 1970. Cytotaxonomic investigations in some Angiosperms collected in the valley of Aosta and in the National Park Gran Paradiso.. Caryologia , 23(3): 363-379.
CCDB · brit-fl — Morton, J.K. Watsonia 3: 307-316 (1956)
CCDB · brit-fl — Morisset, P. Watsonia 12: 145-153 (1978)
CCDB · brit-fl — Morisset, P. Bot. Soc. Brit. Isles Proc. 5: 378-379 (1964)
CCDB · brit-fl — Al-Bermani, A.-K.K.A., Al-Shammary, K.I.A., Bailey, J.P., Gornall, R.J. Watsonia 19: 269-271 (1993)
CCDB · iber-fl — IOPB. Chromosome number reports. LI. Saudo, A., A. Pretel & M. Ruz Rejn.Taxon25(1): 163-164(1976).
CCDB · iber-fl — Variabilit chromosomique chez les especes d'Ononis de la flore espagnole. Note prliminaire. Saudo, A., M. Ruz Rejn & A. Pretel.Webbia34(1): 535-542(1979).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=2934
CCDB · ipcn-api-dl — PALAZUELES, S., A. P. MARTINEZ & M. R. Rejon. 1976. In IOPB chromosome number reports LI. Taxon 25: 155–164.
CCDB · ipcn-api-dl — Al-Bermani, A. K. K. A., K. I. A. Al-Shammary, R. J. Gornall & J. P. Bailey. 1993. Contribution to a cytological catalogue of the British and Irish flora, 3. Watsonia 19: 169–171.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · book-ipcn67-71 — GADELLA, TH. W.J., & E. KLIPHUIS. 1970. Cytotaxonomic investigations in some angiosperms collected in the Valley of Aosta and in the National Park "Gran Paradiso". Carylogia 23: 363-379.
CCDB · book-ipcn67-71 — LEPPER, L. 1970. Beitrage zur Chromosomenzahlen-Dokumentation. Wiss. z. Friedrich-Schiller-Univ. Jena, Math.-Naturwiss. Reihe 19: 369-376.
CCDB · book-ipcn67-71 — GADELLA, Th. W. J., & E. KLIPHUIS. 1967. Chromosome numbers of flowering plants in the Netherlands III. Proc. Roy. Neth. Acad. Sci. Ser. c. 70: 7-20.
CCDB · book-atlas-flowering-plants — Senn 1938
CCDB · CromoCat 2015 — Loon van, J. C. & Kieft, B. (1980a). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXVIII]. Taxon 29(4): 538-542. si
CCDB · CromoCat 2015 — Sañudo, A., A. Pretel & M. Ruiz. (1976). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LI]. Taxon 25(1): 163-164.
CCDB · CromoCat 2015 — Sañudo, A., M. Ruíz Rejón & A. Pretel. (1979). Variabilité chromosomique chez les especes d'Ononis de la flore espagnole. Note préliminaire. Webbia 34(1): 535-542.
CCDB · CromoCat 2015 — Castroviejo & al. (2003). Flora Iberica (vol. I-VIII, X, XIV) Publicaciones del CSIC Madrid
2n 646×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +1
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. IV. Leguminosae Fernandes, A. & M. F. Santos.Bol. Soc. Brot. ser. 245: 177-225(1971).
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. IV. Leguminosae, suppl. 1 Fernandes, A. & M. F. Santos.Bol. Soc. Brot. ser. 249: 173-196(1975).
CCDB · ipcn-api-dl — Fernandes, A. & M. QUEIROS. 1978. Contribution à la connaissance cytotaxinomique des Spermatophyta du Portugal. IV. Leguminosee (Suppl. 3). Bol. Soc. Brot., sér. 2 52: 79–164.
CCDB · book-ipcn67-71 — FERNANDES, A., & M.F. SANTOS. 1971. Contribution a la connaissance cytotaxinomique des Spermatophyta du Portugal IV. Leguminosae. Bol. Soc. Brot. 45 (ser. 2): 177-226.
CCDB · CromoCat 2015 — Fernandes, A. & Santos, M. F. (1971). Contribution à la connaissance cytotaxinomique des spermatophyta du Portugal. IV. Leguminosae. Bol. Soc. Brot. 45: 177-226.
CCDB · CromoCat 2015 — Fernandes, A. & Santos, M. F. (1975). Contribution à la connaissance cytotaxinomique des spermatophyta du Portugal. IV. Leguminosae, suppl. 1 Bol. Soc. Brot. 49: 173-196.
2n 242×CCDB · book-ipcn67-71 · CCDB · book-indian_vol1
CCDB · book-ipcn67-71 — CHUXANOVA, N.A. 1967. Chromosome numbers of some species of Leguminosae Juss. indigenous to the U.S.S.R. (In Russian). Bot. Zhur. 52: 1124-1131.
CCDB · book-indian_vol1 — Chouksanova (Fedorov)
2n 181×CCDB · book-ipcn73-74
CCDB · book-ipcn73-74 — KHARKEVICH, s.s. 1974. New findings of Ononis intermedia C.A. Mey. and Dipsacus gmelini Bieb. in the south o~Ukranian SSR. Ukrajins'k. Bot. Zurn. 31: 107-109.
2n 201×CCDB · book-ipcn73-74
CCDB · book-ipcn73-74 — STRID, A. 1971. Chromosome numbers in some Albanian angiosperms. Bot. Notiser 124: 490-496.
2n 451×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Morisset P. (1978). Chromosome numbers in Ononis L. series Vulgares Širj. Watsonia 12: 145-153
n 159×CCDB · ita-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 +2
CCDB · ita-fl — LARSEN K. - 1956. Chromosome studies in some Mediterranean and South European flowering plants.. Bot. Not. , 109(3): 293-307.
CCDB · ipcn-api-dl — Khatoon, S. & S. I. Ali. 1993. Chromosome Atlas of the Angiosperms of Pakistan. Department of Botany, University of Karachi, Karachi.
CCDB · ipcn-api-dl — Morisset, P. 1978. Chromosome numbers in Ononis L. series Vulgares Sirj. Watsonia 12: 145–153.
CCDB · book-ipcn75-78 — Moris set 1978
CCDB · book-ipcn75-78 — Morisset 1978
CCDB · Cave1956 — Larsen a
CCDB · CromoCat 2015 — Larsen, K. (1956). Chromosome studies in sime mediterranean and south Europena flowering plants Bot. Not. 109: 293-307
CCDB · CromoCat 2015 — Morisset P. (1978). Chromosome numbers in Ononis L. series Vulgares Širj. Watsonia 12: 145-153
n 306×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +2
CCDB · iber-fl — Variabilit chromosomique chez les especes d'Ononis de la flore espagnole. Note prliminaire. Saudo, A., M. Ruz Rejn & A. Pretel.Webbia34(1): 535-542(1979).
CCDB · ipcn-api-dl — Morisset, P. 1978. Chromosome numbers in Ononis L. series Vulgares Sirj. Watsonia 12: 145–153.
CCDB · book-ipcn67-71 — LEPPER, L. 1970. Beitrage zur Chromosomenzahlen-Dokumentation. Wiss. z. Friedrich-Schiller-Univ. Jena, Math.-Naturwiss. Reihe 19: 369-376.
CCDB · book-ipcn75-78 — Morisset 1978
CCDB · CromoCat 2015 — Sañudo, A., M. Ruíz Rejón & A. Pretel. (1979). Variabilité chromosomique chez les especes d'Ononis de la flore espagnole. Note préliminaire. Webbia 34(1): 535-542.
n 53×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Morisset, P. 1978. Chromosome numbers in Ononis L. series Vulgares Sirj. Watsonia 12: 145–153.
CCDB · book-ipcn75-78 — Morisset 1978
CCDB · CromoCat 2015 — Morisset P. (1978). Chromosome numbers in Ononis L. series Vulgares Širj. Watsonia 12: 145-153
n 322×CCDB · iber-fl · CCDB · CromoCat 2015
CCDB · iber-fl — Variabilit chromosomique chez les especes d'Ononis de la flore espagnole. Note prliminaire. Saudo, A., M. Ruz Rejn & A. Pretel.Webbia34(1): 535-542(1979).
CCDB · CromoCat 2015 — Castroviejo & al. (2003). Flora Iberica (vol. I-VIII, X, XIV) Publicaciones del CSIC Madrid
n 161×CCDB · book-ipcn67-71
CCDB · book-ipcn67-71 — LAANE, M.M. 1969. Further chromosome studies in Norwegian vascular plants. Blyttia 27: 5-17.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type115 224 records
Wild obs. + sensor110 990
Museum / vouchered3 512
Cultivated / captive62
Other660
Origin
Native5 118
Introduced28
Range
Area of Occupancy AOO144 252 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy22% within 1 km
≤100 m 12 317≤1 km 7 884≤10 km 69 212>10 km 489
89 902 georeferenced · 21 088 without coordinates
Open the mapobservation + sensor110 990
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy29% within 1 km
≤100 m 124≤1 km 704≤10 km 1 950>10 km 31
2 809 georeferenced · 703 without coordinates
Open the institutions mapphysical evidence3 512
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy2% within 1 km
≤1 km 1≤10 km 6>10 km 35
42 georeferenced · 20 without coordinates
Open the mapnot free-living62
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions66 of 132 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 1 786 |
| MeiseBGlocation not on record | 173 |
| Adam Mickiewicz University in Poznańlocation not on record | 99 |
| Salzburg, AT | 85 |
| Lausanne, CH | 84 |
| MAlocation not on record | 76 |
| València, ES | 62 |
| Uniwersytet Warszawskilocation not on record | 52 |
| LDlocation not on record | 47 |
| BRNUlocation not on record | 47 |
| Berlin, DE | 44 |
| Museo Entomologico de Leonlocation not on record | 43 |
| Bern, CH | 43 |
| CJBGlocation not on record | 41 |
| South Kensington, GB | 37 |
| BDBClocation not on record | 32 |
| BClocation not on record | 31 |
| Provincia di Livornolocation not on record | 31 |
| Olocation not on record | 30 |
| BIO-UNIPIlocation not on record | 29 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 26 |
| Entomological Society of Latvialocation not on record | 20 |
| SZUlocation not on record | 20 |
| CICYTEXlocation not on record | 18 |
| Barcelona, ES | 18 |
| BSBIlocation not on record | 15 |
| Oskarshamn, SE | 14 |
| Wlocation not on record | 14 |
| Salamanca, ES | 14 |
| Alicante, ES | 14 |
| Uniwersytet Jagiellońskilocation not on record | 14 |
| Mlocation not on record | 13 |
| BFLlocation not on record | 13 |
| Trondheim, NO | 12 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 11 |
| Uppsala, SE | 11 |
| Görlitz, DE | 11 |
| GJOlocation not on record | 10 |
| Madrid, ES | 10 |
| Bergen, NO | 10 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 10 |
| Philadelphia, US | 9 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 9 |
| Bronx, US | 7 |
| Porrentruy, CH | 7 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 7 |
| Uniwersytet Śląski w Katowicachlocation not on record | 6 |
| PRClocation not on record | 6 |
| Hobart, AU | 6 |
| Karlsruhe, DE | 6 |
| Frauenfeld, CH | 6 |
| Phyletisches Museum Jenalocation not on record | 5 |
| Vitoria, ES | 5 |
| UIBlocation not on record | 5 |
| Saint Louis, US | 4 |
| Moscow State Universitylocation not on record | 4 |
| Santiago de Compostela, ES | 4 |
| JBSlocation not on record | 4 |
| TROMlocation not on record | 4 |
| University of Gdansk, Dept. of Plant Taxonomy & Nature Conservationlocation not on record | 4 |
| OLAlocation not on record | 4 |
| College of the Atlantic, Museumlocation not on record | 4 |
| LfUlocation not on record | 4 |
| Museo Achille Folettolocation not on record | 4 |
| Canberra, AU | 3 |
| Russian Academy of Sciences, Komarov Botanical Institutelocation not on record | 3 |
| Fulda, DE | 3 |
| SLU Artdatabankenlocation not on record | 3 |
| Xiamen, CN | 3 |
| NBSIlocation not on record | 3 |
| Rishon Le Zion, IL | 3 |
| Dresden, DE | 3 |
| National Museum Waleslocation not on record | 3 |
| Museum of the Rockieslocation not on record | 2 |
| Bourges, FR | 2 |
| Winterthur, CH | 2 |
| Chongqing Museumlocation not on record | 2 |
| Frankfurt am Main | 2 |
| Pullman, US | 2 |
| Stockholm, SE | 2 |
| Podgorica, ME | 2 |
| Edinburgh, GB | 2 |
| Rotorua, NZ | 2 |
| NMBU:MINAlocation not on record | 2 |
| Monastir, TN | 2 |
| FLADlocation not on record | 2 |
| Taipei, TW | 2 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 2 |
| Wellington, NZ | 2 |
| Pamplona, ES | 2 |
| Glarus, CH | 2 |
| Kew, GB | 2 |
| Vancouver, CA | 1 |
| KMNlocation not on record | 1 |
| John May Museum of Natural Historylocation not on record | 1 |
| Denver, US | 1 |
| Sant Julià de Lòria, AD | 1 |
| Columbia, US | 1 |
| University of Guelph, OAC Herbariumlocation not on record | 1 |
| Helsinki, FI | 1 |
| Davis, US | 1 |
| Tromso University Museumlocation not on record | 1 |
| BGBMlocation not on record | 1 |
| Clemson, US | 1 |
| Zürich, CH | 1 |
| Adelaide, AU | 1 |
| GZUlocation not on record | 1 |
| Natural History Museum Rotterdamlocation not on record | 1 |
| UniKSlocation not on record | 1 |
| Granada, ES | 1 |
| Uniwersytet Opolskilocation not on record | 1 |
| Boumlocation not on record | 1 |
| UoB-IBlocation not on record | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| Kuopio, FI | 1 |
| Beijing, CN | 1 |
| University of Copenhagen, Natural History Museum of Denmark, Herbarium Clocation not on record | 1 |
| McWane Science Centerlocation not on record | 1 |
| Bloomington, US | 1 |
| Göteborg, SE | 1 |
| Mount Annan, AU | 1 |
| Badajoz, ES | 1 |
| STUlocation not on record | 1 |
| Flagstaff, US | 1 |
| Brussel, BE | 1 |
| Jyväskylä, FI | 1 |
| Oswego, US | 1 |
| ULBF-AGRlocation not on record | 1 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 1 |
| Sion, CH | 1 |
| Auckland, NZ | 1 |
| Sevilla, ES | 1 |
132 institutions · 3 399 of 3 512 vouchered records shown · 113 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA52 detections
Where the DNA of Ononis spinosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found52
Studies independent surveys1
Countries15
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 52 detections have coordinates
Open the map15 countries0
naturalised
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median16.9 °C 14.1–22.0
Seasonal swing summer↔winter18.5 °C
Max temp (day)20.2 °C 17.7–26.8
Min temp (night)13.5 °C 10.6–17.1
Precipitation77.0 mm/mo 28.8–90.1
Air humidity61.4 % 54.5–63.4
Moisture balance-45.4 mm/mo -102–24.3
Vapour deficit735 Pa 598–1,217
Wind speed3.80 m/s 2.40–5.50
Cloud cover35.6 % 18.0–49.6
CHELSA 1981–2010, ~9 km grid, at location & month of 40 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.