Ononis natrix
speciesAt a glance
Occurrence records33 011
Data sources12
Biological traits34
DNA specimens2
eDNA detections4
Sources12 archives
Databases and archives Ononis natrix's data was compiled from.
WikipediaWikimedia Foundation10 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility33 011 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics2 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources34 traits
Chemical compositionLOTUS76 compounds
Occurrence & distributionGBIF33 011 records
Environmental DNA1 datasets · 0 countries4 detections
DNA & barcodingBOLD · NCBI2 specimens
Genome at a glanceCCDB2n = 32
01Narrative
Ononis natrix, the yellow restharrow or shrubby rest-harrow, is a species of plant in the family Fabaceae.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology10
Leaf length max7 mm
Leaf length min2 mm
Plant height0.35 m
⚠ sources differ — GIFT: 0.35 m · LEDA: 0.35 m · TRY: 0.25 m
Plant height generative0.35 m
Plant height max0.5 m
Plant height min0.2 m
Seed length2 mm
Seed mass3.28 mg
⚠ sources differ — TRY: 3.28 mg · LEDA: 2.99 mg · GIFT: 3.23 mg
Seed mass max9.39 mg
Seed mass min1.08 mg
Life cycle & reproduction10
Deciduousnessaestival
⚠ sources differ — TRY: aestival · GIFT: deciduous
Flower colourorange
Flower length max12 mm
Flower length min10 mm
Flowering endJul
Flowering startMar
Life formsubshrub or perennial
Life spanperennial
Lifespan years3.5 years
Raunkiær life formhemicryptophyte
Diet & foraging1
Parasiteindependent
Habitat & environment10
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max100 m
Elevation min0 m
Epiphyteterrestrial
Growth formshrub
Leaf formlanceolate
Mycorrhiza type0.000000113
Woodinessnon-woody
Physiology & chemistry1
Photosynthetic pathwayC3
Other traits2
Diaspore typeseed
Plant support typefree-standing
03Chemical composition76 compounds
Compounds documented for Ononis natrix across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Chalcones9
Pterocarpan8
Isocoumarins7
Flavones5
Unsaturated fatty acids5
Documented compounds76 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (-)-3-Hydroxy-9-methoxypterocarpan | present | LOTUS | |
| (-)-Maackiain | present | LOTUS | |
| (-)-maackiain-3-O-glucoside | present | LOTUS | |
| (12R)-13-(3,5-dihydroxyphenyl)-12-hydroxytridecan-6-one | present | LOTUS | |
| (2E,6E,10E,14E,18E)-3,7,11,15,19,23-hexamethyltetracosa-2,6,10,14,18,22-hexaen-1-ol | present | LOTUS | |
| (2E,6E,10E,14E,18E,22E,26E)-3,7,11,15,19,23,27,31-octamethyldotriaconta-2,6,10,14,18,22,26,30-octaen-1-ol | present | LOTUS | |
| (2R,8S)-1-(3-hydroxy-5-methoxyphenyl)tridecane-2,8-diol | present | LOTUS | |
| (2S)-pinocembrin | present | LOTUS | |
| (3R)-3-[(4S)-4-hydroxyundecyl]-3,4-dihydro-1H-isochromene-6,8-diol | present | LOTUS | |
| (3R)-3-undecyl-3,4-dihydro-1H-isochromene-6,8-diol | present | LOTUS |
05DNA & barcoding2 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ononis natrix has left across the world's sequence archives.
At a glance
DNA specimens2
Marker genes3
GenBank sequences4
eDNA detections4
Countries1
The DNA barcodea real sequence read deposited for this species
GAAGTTGGACGACATAGTGCGTCTTCCTTTGTGCCAAACCCAAACCCCGGCGCGGAATGCGTCAAGGAATTTCAATTTTGTTCTTAGCAC …
Ononis natrix subsp. arganietorum internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★rbcL1★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Ononis natrix carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 32 n = 16
Ploidydiploid inferred
Chromosome records16–642n range32median32mode56records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 3242×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn72 +3
CCDB · iber-fl — IOPB. Chromosome number reports. LI. Saudo, A., A. Pretel & M. Ruz Rejn.Taxon25(1): 163-164(1976).
CCDB · iber-fl — Variabilit chromosomique chez les especes d'Ononis de la flore espagnole. Note prliminaire. Saudo, A., M. Ruz Rejn & A. Pretel.Webbia34(1): 535-542(1979).
CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. IX. Cruciferae Fernandes, A., M. F. Santos & M. Queirs.Bol. Soc. Brot. ser. 251: 137-186(1977).
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. IV. Leguminosae, suppl. 1 Fernandes, A. & M. F. Santos.Bol. Soc. Brot. ser. 249: 173-196(1975).
CCDB · iber-fl — IOPB. Chromosome number reports. LXXIX. Cardona, M. A. & J. Contandriopoulos.Taxon32(2): 323-324(1983).
CCDB · ipcn-api-dl — Parra, R., B. Valdes, I. Gordillo & R. Venanzi. 1999. Mediterranean chromosome number reports 9 (1075--1082). Fl. Medit. 9: 368–370.
CCDB · ipcn-api-dl — SANUDO, A., M. R. Rejon & A. Pretel. 1979. Variabilite chromosomique chez les especes d'Ononis de la Flora Espagnole. Note preliminaire. Webbia 34: 535–542.
CCDB · ipcn-api-dl — PALAZUELES, S., A. P. MARTINEZ & M. R. Rejon. 1976. In IOPB chromosome number reports LI. Taxon 25: 155–164.
CCDB · ipcn-api-dl — Kliphuis, E. & Y. I. Barkoudah. 1977. Chromosome numbers in some Syrian angiosperms. Acta Bot. Neerl. 26: 239–249.
CCDB · ipcn-api-dl — Cardona, M. A. & J. Contandriopoulos. 1983. In IOPB chromosome number reports LXXIX. Taxon 32: 323–324.
CCDB · ipcn-api-dl — Fernandes, A. & M. QUEIROS. 1978. Contribution à la connaissance cytotaxinomique des Spermatophyta du Portugal. IV. Leguminosee (Suppl. 3). Bol. Soc. Brot., sér. 2 52: 79–164.
CCDB · ipcn-api-dl — Fernandes, A., M. F. SANTOS & H. FATIMA. 1975. Contribution à la connaissance cytotaxinomique des Spermatophyta du Portugal. IV. Leguminosae (Suppl. 1). Bol. Soc. Brot., sér. 2 49: 173–196.
CCDB · ipcn-api-dl — Fernandes, A., M. F. SANTOS & M. QUEIROS. 1977. Contribution à la connaissance cytotaxonomique des Spermatophyta de Portugal. Leguminosae. Bol. Soc. Brot., sér. 2 51: 137–186.
CCDB · ipcn-api-dl — Natarajan, G. 1977. Contribution à l'etude caryosystematique des especes de la garrigue languedocienne. These, Academie de Montpellier, France.
CCDB · ipcn-api-dl — Natarajan, G. 1978. In IOPB chromosome number reports LXII. Taxon 27: 519–535.
CCDB · book-ipcn72 — KLIPHUIS, E . & J.H. WIEFFERING. 1972. Chromosome numbers of some Angiosperms from the South of France. Acta Bot. Neer!. 21: 598-604.
CCDB · book-ipcn75-78 — Kliphuis & Barkoudah 1977
CCDB · book-ipcn75-78 — Palazueles et al. 1976
CCDB · book-ipcn75-78 — Fernandes & Queiros 1978
CCDB · book-ipcn75-78 — Fernandes
CCDB · book-ipcn75-78 — Natarajan 1978
CCDB · book-ipcn75-78 — Natarajan 1977
CCDB · book-ipcn75-78 — Fernandes & Santos 1975
CCDB · book-atlas-flowering-plants
CCDB · CromoCat 2015 — Sañudo, A., M. Ruíz Rejón & A. Pretel. (1979). Variabilité chromosomique chez les especes d'Ononis de la flore espagnole. Note préliminaire. Webbia 34(1): 535-542.
CCDB · CromoCat 2015 — Kliphuis, E. & Barkoudah, Y. I. (1977). Chromosome numbers in some Syrian Angiosperms. Acta Bot. Neerl. 26: 239-249.
CCDB · CromoCat 2015 — Parra, R., B. Valdés, I. Gordillo & R. Venanzi (1999b). Mediterranean chromosome number reports-9. Fl. Medit. 9: 368-370.
CCDB · CromoCat 2015 — Sañudo, A., A. Pretel & M. Ruiz. (1976). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LI]. Taxon 25(1): 163-164.
CCDB · CromoCat 2015 — Tschechow, W. (1933). Karyosistematische analyse des tribus Trifoliae DC. (Fam. Leguminosae Juss.). (Vorl. Mitt.). Bull. Appl. Bot., Genet. & Plant Breeding 1: 119-143.
CCDB · CromoCat 2015 — Kliphuis, E. & Wieffering, J. H. (1972). Chromosome numbers of some Angiosperms from the South of France. Acta Bot. Neerl. 21: 598-604.
CCDB · CromoCat 2015 — Natarajan, G. (1978b). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXII]. Taxon 27(5/6): 526-531.
CCDB · CromoCat 2015 — Fernandes, A., Santos, M. F. & Queirós, M. (1977a). Contribuiçao para o conhecimento citotaxonómico das Spermatophyta de Portugal. IX. Cruciferae. Bol. Soc. Brot. 51: 137-186.
CCDB · CromoCat 2015 — Fernandes, A. & Santos, M. F. (1975). Contribution à la connaissance cytotaxinomique des spermatophyta du Portugal. IV. Leguminosae, suppl. 1 Bol. Soc. Brot. 49: 173-196.
CCDB · CromoCat 2015 — Cardona, M. À. & Contandriopoulos, J. (1983). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXIX]. Taxon 32(2): 323-324.
2n 306×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 +1
CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 1-14. Valds, B., J. Pastor & J. Ubera.Lagascalia7(2): 192-197(1977).
CCDB · ipcn-api-dl — Valdes, B. 1978. In Numeros cromosomicas para la flora Espanola. 45-83. Lagascalia 8: 105–125.
CCDB · ipcn-api-dl — Valdes, B., J. Pastor & J. Ubera. 1978. In Numeros cromosomicos para la flora Espariola. 1-44. Lagascalia 7: 191–216.
CCDB · book-ipcn75-78 — Valdes et al. 1978
CCDB · CromoCat 2015 — Castroviejo & al. (2003). Flora Iberica (vol. I-VIII, X, XIV) Publicaciones del CSIC Madrid
CCDB · CromoCat 2015 — Valdés, B., J. Pastor & J. Ubera. (1977). Números cromosómicos para la flora española, 1-14. Lagascalia 7(2): 192-197.
2n 644×CCDB · iber-fl · CCDB · book-ipcn67-71 · CCDB · CromoCat 2015
CCDB · iber-fl — Chromosome numbers in Iberian angiosperms. Bjorkqvist, I. & al.Bot. Not.122: 271-283(1969).
CCDB · book-ipcn67-71 — BJ.ORKQVIST, I . , R. VON BOTHMER, O. NILSSON: & B. NORDENSTAM. 1969. Chromosome numbers in Iberian Angiosperms. Bot. Notiser 122: 271-28;
CCDB · CromoCat 2015 — Castroviejo & al. (2003). Flora Iberica (vol. I-VIII, X, XIV) Publicaciones del CSIC Madrid
CCDB · CromoCat 2015 — Björkqvist, I., von Bothmer, R., Nilsson, O. & Nordenstam, B. (1969). Chromosome numbers in Iberian angiosperms. Bot. Not. 122: 271-283.
2n 283×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · iber-fl — Sobre los niveles de ploida y otras particularidades... Elena Rossell, J. A., M. A. Gonzlez Zapatero & F. Navarro Andrs.Stud. Bot. Univ. Salamanca4: 109-115(1987).
CCDB · ipcn-api-dl — Elena Rossello, J. A., M. A. G. Zapatero & F. N. Andres. 1985. Sobre los niveles de ploidia y otras particularidades cromosomicas de algunos vegetales Castellano-Leoneses de preferencias calcicolas. Stud. Bot. Univ. Salamanca 4: 109–115.
CCDB · CromoCat 2015 — Elena Rosselló, J. A., González Zapatero, M. A. & Navarro Andrés, F. (1987c). Sobre los niveles de ploidía y otras particularidades... Stud. Bot. Univ. Salamanca 4: 109-115.
2n 161×CCDB · book-ipcn75-78
CCDB · book-ipcn75-78 — NA
n 168×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 +3
CCDB · iber-fl — Variabilit chromosomique chez les especes d'Ononis de la flore espagnole. Note prliminaire. Saudo, A., M. Ruz Rejn & A. Pretel.Webbia34(1): 535-542(1979).
CCDB · ipcn-api-dl — SANUDO, A., M. R. Rejon & A. Pretel. 1979. Variabilite chromosomique chez les especes d'Ononis de la Flora Espagnole. Note preliminaire. Webbia 34: 535–542.
CCDB · ipcn-api-dl — Humphries, C. J., B. G. Murray, G. Bocquet & K. N. Vasudevan. 1978. Chromosome numbers of phanerogams from Morocco and Algeria. Bot. Not. 131: 391–404.
CCDB · book-ipcn75-78 — Humphries 1978
CCDB · book-ipcn73-74 — RASHID, A. 1974. Chromosome number of some Mediterranean plants. Bangladesh J. Bot. 3: 75-82.
CCDB · Cannon, 2015 — Dalgaard, V., 1991
CCDB · CromoCat 2015 — Sañudo, A., A. Pretel & M. Ruiz. (1976). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LI]. Taxon 25(1): 163-164.
CCDB · CromoCat 2015 — Sañudo, A., M. Ruíz Rejón & A. Pretel. (1979). Variabilité chromosomique chez les especes d'Ononis de la flore espagnole. Note préliminaire. Webbia 34(1): 535-542.
n 151×CCDB · book-ipcn75-78
CCDB · book-ipcn75-78 — NA
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
07Deep time~18.5 Ma lineage
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
DNA clock origin18.5 Ma TimeTree
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.
DNA clock origin
08Occurrence & distribution
Record type33 011 records
Wild obs. + sensor31 594
Museum / vouchered1 292
Cultivated / captive3
Other122
Origin
Native871
Range
Area of Occupancy AOO39 428 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy26% within 1 km
≤100 m 4 693≤1 km 1 926≤10 km 18 285>10 km 230
25 134 georeferenced · 6 460 without coordinates
Open the mapobservation + sensor31 594
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy53% within 1 km
≤100 m 29≤1 km 262≤10 km 248>10 km 9
548 georeferenced · 744 without coordinates
Open the institutions mapphysical evidence1 292
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 1
1 georeferenced · 2 without coordinates
Open the mapnot free-living3
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions48 of 92 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| MAlocation not on record | 121 |
| Zürich, CH | 109 |
| Zürich, CH | 100 |
| BClocation not on record | 78 |
| València, ES | 76 |
| College of the Atlantic, Museumlocation not on record | 66 |
| BIO-UNIPIlocation not on record | 56 |
| CJBGlocation not on record | 45 |
| CICYTEXlocation not on record | 29 |
| LDlocation not on record | 26 |
| Adam Mickiewicz University in Poznańlocation not on record | 25 |
| Wlocation not on record | 25 |
| Granada, ES | 23 |
| Phyletisches Museum Jenalocation not on record | 22 |
| BDBClocation not on record | 22 |
| Madrid, ES | 19 |
| Saint Louis, US | 19 |
| Salamanca, ES | 18 |
| UIBlocation not on record | 17 |
| MeiseBGlocation not on record | 17 |
| Bern, CH | 17 |
| ISAlocation not on record | 16 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 15 |
| Alicante, ES | 15 |
| Barcelona, ES | 14 |
| Paris, FR | 11 |
| Pamplona, ES | 11 |
| Oskarshamn, SE | 10 |
| Badajoz, ES | 10 |
| BRNUlocation not on record | 8 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 8 |
| UGentlocation not on record | 8 |
| Jaén, ES | 8 |
| EEZA-CSIClocation not on record | 8 |
| Berlin, DE | 8 |
| Bourges, FR | 8 |
| Uniwersytet Jagiellońskilocation not on record | 7 |
| GJOlocation not on record | 7 |
| Frankfurt am Main | 7 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 7 |
| Entomological Society of Latvialocation not on record | 7 |
| Kew, GB | 6 |
| Vitoria, ES | 6 |
| Porrentruy, CH | 6 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 5 |
| Görlitz, DE | 5 |
| University of Stellenboschlocation not on record | 5 |
| Monastir, TN | 4 |
| Rishon Le Zion, IL | 4 |
| Sion, CH | 4 |
| JBSlocation not on record | 4 |
| South Kensington, GB | 4 |
| Henry Brockhouse Collectionlocation not on record | 4 |
| Lausanne, CH | 4 |
| Sant Julià de Lòria, AD | 4 |
| Córdoba, ES | 4 |
| Pretoria, ZA | 4 |
| Philadelphia, US | 3 |
| Sevilla, ES | 3 |
| Bronx, US | 3 |
| Moscow State Universitylocation not on record | 3 |
| Santiago de Compostela, ES | 2 |
| Boumlocation not on record | 2 |
| STUlocation not on record | 2 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 2 |
| Tilburg, NL | 2 |
| GZUlocation not on record | 2 |
| Musée des Confluenceslocation not on record | 2 |
| Porto Alegre, BR | 2 |
| Museo Achille Folettolocation not on record | 1 |
| Canadian Department of Agriculturelocation not on record | 1 |
| ESP145location not on record | 1 |
| Pamplona, ES | 1 |
| ESP109location not on record | 1 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 1 |
| Chongqing Museumlocation not on record | 1 |
| OLAlocation not on record | 1 |
| Flagstaff, US | 1 |
| Dresden, DE | 1 |
| Fribourg, CH | 1 |
| PRClocation not on record | 1 |
| Denver, US | 1 |
| Uniwersytet Śląski w Katowicachlocation not on record | 1 |
| Phoenix, US | 1 |
| Stockholm, SE | 1 |
| Muséum Henri Lecoqlocation not on record | 1 |
| Uppsala, SE | 1 |
| Tuscaloosa, US | 1 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 1 |
| Boise, US | 1 |
| Podgorica, ME | 1 |
| Bloomington, US | 1 |
92 institutions · 1 247 of 1 292 vouchered records shown · 45 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA4 detections
Where the DNA of Ononis natrix was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found4
Studies independent surveys1
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 4 detections have coordinates
Open the map0 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.