Ononis mitissima

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Ononis

At a glance

Occurrence records7 579

Data sources12

Biological traits32

DNA specimens2

eDNA detections2

Sources12 archives

Databases and archives Ononis mitissima's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility7 579 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Paleobiology DatabasePBDB consortiumfossil record↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources32 traits

Chemical compositionLOTUS5 compounds

Occurrence & distributionGBIF7 579 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 30

01Narrative

Ononis mitissima is a species of annual herb in the family Fabaceae. They have a self-supporting growth form and broad leaves. Individuals can grow to 5 cm tall.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology11

Fruit length max7 mm

Fruit length min5 mm

Leaf length max22 mm

Leaf length min2 mm

Leaf width max13 mm

Leaf width min2 mm

Plant height0.05 m

Plant height max0.6 m

Seed mass2.71 mg

Seed mass max2.73 mg

Seed mass min2.68 mg

Life cycle & reproduction9

Flower colourpink

Flower length max12 mm

Flower length min9 mm

Flowering endJun

Flowering startApr

Life formannual

Life spanannual

Lifespan years1 years

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max2 000 m

Elevation min0 m

Epiphyteterrestrial

Fruit typelegume

Growth formherb

Leaf formelliptic

Woodinessnon-woody

Other traits1

Shoot orientationascending

03Chemical composition5 compounds

Compounds documented for Ononis mitissima across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Pterocarpan5

Documented compounds5 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-3-Hydroxy-9-methoxypterocarpan	present	LOTUS
(-)-Maackiain	present	LOTUS
9-ethoxy-6a,11a-dihydro-6H-[1]benzofuro[3,2-c]chromen-3-ol	present	LOTUS
Medicarpin	present	LOTUS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ononis mitissima has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences3

eDNA detections2

The DNA barcodea real sequence read deposited for this species

ITSGQ488497.1 ↗587 bp

ACGT

TTTCAACATACTAGGTTTTGCTTGAGGTGTTAAAACTTCTTGCAATACCTTTGGTTTGAAGGTAGACGACATAGTGCGTCCTCCTTTCTA …

Ononis mitissima internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Ononis mitissima carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 30 n = 15

Ploidydiploid inferred

Chromosome records30–302n range30median30mode9records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 309×CCDB · ita-fl · CCDB · nw-europe-fl · CCDB · ipcn-api-dl +3

CCDB · ita-fl — COLOMBO P., MARCEN C., PRINCIOTTA R. - 1983. Numeros cromosomaticos de plantas occidentales, 200-210.. Anales Jard. Bot. Madrid , 39(2): 519-524.

CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=2935

CCDB · ipcn-api-dl — Fernandes, A. & M. QUEIROS. 1978. Contribution à la connaissance cytotaxinomique des Spermatophyta du Portugal. IV. Leguminosee (Suppl. 3). Bol. Soc. Brot., sér. 2 52: 79–164.

CCDB · book-ipcn67-71 — FERNANDES, A., & M.F. SANTOS. 1971. Contribution a la connaissance cytotaxinomique des Spermatophyta du Portugal IV. Leguminosae. Bol. Soc. Brot. 45 (ser. 2): 177-226.

CCDB · book-ipcn75-78 — Fernandes & Queiros 1978

CCDB · CromoCat 2015 — Colombo, P., Marcenó, C. & Princiotta, R. (1983a). Números cromosomáticos de plantas occidentales, 200-210. Anales Jard. Bot. Madrid 39: 519-524.

CCDB · CromoCat 2015 — Fernandes, A. & Queirós, M. (1978a). Contribuiçao para o conhecimento citotaxonómico das Spermatophyta de Portugal. IX. Cruciferae. Bol. Soc. Brot. 52: 79-164.

CCDB · CromoCat 2015 — Fernandes, A. & Santos, M. F. (1971). Contribution à la connaissance cytotaxinomique des spermatophyta du Portugal. IV. Leguminosae. Bol. Soc. Brot. 45: 177-226.

CCDB · CromoCat 2015 — Fernandes, A., Santos, M. F. & Queirós, M. (1977a). Contribuiçao para o conhecimento citotaxonómico das Spermatophyta de Portugal. IX. Cruciferae. Bol. Soc. Brot. 51: 137-186.

n 152×CCDB · ipcn-api-dl · CCDB · CromoCat 2015

CCDB · ipcn-api-dl — SANUDO, A., M. R. Rejon & A. Pretel. 1979. Variabilite chromosomique chez les especes d'Ononis de la Flora Espagnole. Note preliminaire. Webbia 34: 535–542.

CCDB · CromoCat 2015 — Sañudo, A., M. Ruíz Rejón & A. Pretel. (1979). Variabilité chromosomique chez les especes d'Ononis de la flore espagnole. Note préliminaire. Webbia 34(1): 535-542.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type7 579 records

Wild obs. + sensor7 219

Museum / vouchered348

Cultivated / captive2

Other10

Origin

Native91

Range

Area of Occupancy AOO4 196 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy45% within 1 km

≤100 m 2 680≤1 km 153≤10 km 3 523>10 km 9

6 365 georeferenced · 854 without coordinates

Open the mapobservation + sensor7 219

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy60% within 1 km

≤100 m 11≤1 km 53≤10 km 42

106 georeferenced · 242 without coordinates

Open the institutions mapphysical evidence348

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions22 of 44 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
LDlocation not on record	71
BClocation not on record	33
BIO-UNIPIlocation not on record	33
MAlocation not on record	31
ISAlocation not on record	18
College of the Atlantic, Museumlocation not on record	15
Córdoba, ES	11
South Kensington, GB	11
Badajoz, ES	10
València, ES	9
CICYTEXlocation not on record	9
UIBlocation not on record	8
Wlocation not on record	6
Sevilla, ES	6
Museo della Bonifica di San Donà di Piavelocation not on record	5
Berlin, DE	5
Salamanca, ES	5
Kew, GB	4
Granada, ES	4
Universidad del Pais Vasco (UPV/EHU)location not on record	4
BDBClocation not on record	4
Coimbra, PT	3
Jaén, ES	3
Entomological Society of Latvialocation not on record	3
Institut und Museum fuer Geologie und Palaeontologielocation not on record	3
San Jose State University, Museum of Birds and Mammalslocation not on record	2
Alicante, ES	2
BSBIlocation not on record	2
Vitoria, ES	2
CJBGlocation not on record	2
LfUlocation not on record	1
Museo Achille Folettolocation not on record	1
Taipei, TW	1
San Sebastián, ES	1
Phyletisches Museum Jenalocation not on record	1
Hunan Geological Museumlocation not on record	1
Pamplona, ES	1
Pamplona, ES	1
Saint Louis, US	1
Rishon Le Zion, IL	1
Paris, FR	1
Barcelona, ES	1
Bronx, US	1
GZUlocation not on record	1

44 institutions · 338 of 348 vouchered records shown · 10 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Ononis mitissima was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ononis mitissima

At a glance

Sources12 archives

Size & morphology11

Life cycle & reproduction9

Diet & foraging1

Habitat & environment10

Other traits1

Compound class profile1 class

Documented compounds5 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type7 579 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions22 of 44 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type7 579 records