Ononis biflora

Desf. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Ononis

At a glance

Occurrence records358

Data sources11

Biological traits8

DNA specimens2

eDNA detections2

Sources11 archives

Databases and archives Ononis biflora's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility358 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources8 traits

Chemical compositionLOTUS5 compounds

Occurrence & distributionGBIF358 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 32

01Narrative

Ononis biflora is a species of plants in the family Fabaceae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction3

Life formannual

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment4

Aquaticterrestrial

Climatesubtropical

Growth formherb

Woodinessnon-woody

03Chemical composition5 compounds

Compounds documented for Ononis biflora across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Pterocarpan5

Documented compounds5 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-3-Hydroxy-9-methoxypterocarpan	present	LOTUS
(-)-Maackiain	present	LOTUS
9-ethoxy-6a,11a-dihydro-6H-[1]benzofuro[3,2-c]chromen-3-ol	present	LOTUS
Medicarpin	present	LOTUS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ononis biflora has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences2

eDNA detections2

The DNA barcodea real sequence read deposited for this species

ITSGQ488478.1 ↗574 bp

ACGT

TTTCAACATATTAGGTTTTGCTTGCGGCGTTCAACGCCAATGGCTTGCCTTTGGTTTTGAAGGTGGACGACGTAGTGCGTCTTCCTTTGT …

Ononis biflora internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Ononis biflora carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 32 n = 16

Ploidydiploid inferred

Chromosome records32–322n range32median32mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 325×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 +1

CCDB · iber-fl — Variabilit chromosomique chez les especes d'Ononis de la flore espagnole. Note prliminaire. Saudo, A., M. Ruz Rejn & A. Pretel.Webbia34(1): 535-542(1979).

CCDB · ipcn-api-dl — SANUDO, A., M. R. Rejon & A. Pretel. 1979. Variabilite chromosomique chez les especes d'Ononis de la Flora Espagnole. Note preliminaire. Webbia 34: 535–542.

CCDB · ipcn-api-dl — Fernandes, A. & M. QUEIROS. 1978. Contribution à la connaissance cytotaxinomique des Spermatophyta du Portugal. IV. Leguminosee (Suppl. 3). Bol. Soc. Brot., sér. 2 52: 79–164.

CCDB · book-ipcn75-78 — Fernandes & Queiros 1978

CCDB · book-atlas-flowering-plants — Algeria

n 164×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn73-74

CCDB · iber-fl — IOPB. Chromosome number reports. XLVI. Saudo, A.Taxon23(5/6): 804(1974).

CCDB · iber-fl — Variabilit chromosomique chez les especes d'Ononis de la flore espagnole. Note prliminaire. Saudo, A., M. Ruz Rejn & A. Pretel.Webbia34(1): 535-542(1979).

CCDB · ipcn-api-dl — SANUDO, A., M. R. Rejon & A. Pretel. 1979. Variabilite chromosomique chez les especes d'Ononis de la Flora Espagnole. Note preliminaire. Webbia 34: 535–542.

CCDB · book-ipcn73-74 — SANUDO, A. 1974. In IOPB chromosome number reports XLVI. Taxon 23: 801-812.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type358 records

Wild obs. + sensor245

Museum / vouchered111

Cultivated / captive1

Other1

Origin

Native1

Range

Area of Occupancy AOO900 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy48% within 1 km

≤100 m 46≤1 km 12≤10 km 61>10 km 3

122 georeferenced · 123 without coordinates

Open the mapobservation + sensor245

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy65% within 1 km

≤100 m 7≤1 km 23≤10 km 15>10 km 1

46 georeferenced · 65 without coordinates

Open the institutions mapphysical evidence111

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
LDlocation not on record	19
Badajoz, ES	15
CICYTEXlocation not on record	11
Córdoba, ES	11
MAlocation not on record	10
BClocation not on record	10
València, ES	6
Museo Achille Folettolocation not on record	4
Salamanca, ES	3
Wlocation not on record	3
BIO-UNIPIlocation not on record	2
Entomological Society of Latvialocation not on record	2
Oskarshamn, SE	1
Rishon Le Zion, IL	1
Saint Louis, US	1
Santiago de Compostela, ES	1
Berlin, DE	1
Barcelona, ES	1
Moscow State Universitylocation not on record	1
College of the Atlantic, Museumlocation not on record	1
Granada, ES	1
South Kensington, GB	1
Paris, FR	1
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1
Pamplona, ES	1

25 institutions · 109 of 111 vouchered records shown · 2 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Ononis biflora was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)