Onobrychis viciifolia
Scop. · speciesAt a glance
Occurrence records91 757
Data sources14
Biological traits130
DNA specimens53
eDNA detections35
Sources14 archives
Databases and archives Onobrychis viciifolia's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility91 757 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI35 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics53 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements6 literature sources130 traits
Chemical compositionLOTUS · NPASS83 compounds
Occurrence & distributionGBIF91 757 records
Environmental DNA1 datasets · 5 countries35 detections
DNA & barcodingBOLD · NCBI53 specimens
Genome at a glanceCCDB · GoaT1.4 Gbp
01Narrative
Le sainfoin cultivé, encore appelé esparcette cultivée ou esparcette à feuilles de vesce, est une espèce de plantes à fleurs de la famille des Fabacées. C'est une plante herbacée des prairies peu amendées et qui était autrefois très cultivée comme fourrage. On la retrouve aussi dans les friches et les terrains vagues surtout sur substrat calcaire.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDAUSDATRYWCVP
Size & morphology17
Fruit length6 mm
Leaf length32.5 mm
Leaf length max120 mm
Leaf length min40 mm
Leaf mass155 mg
Leaf size2 097 mm²
⚠ sources differ — TRY: 2 097 mm² · LEDA: 2 823 mm² · GIFT: 3 134 mm²
Leaf width5 mm
Leaf width max7 mm
Leaf width min3 mm
Plant height0.517 m
⚠ sources differ — GIFT: 0.517 m · AusTraits: 0.8 m · LEDA: 0.35 m · USDA: 0.762 m · TRY: 0.602 m
Plant height generative0.45 m
Plant height max0.8 m
Plant height min0.15 m
Seed length6.47 mm
⚠ sources differ — TRY: 6.47 mm · AusTraits: 4 mm
Seed mass18.09 mg
⚠ sources differ — TRY: 18.09 mg · LEDA: 19.79 mg · GIFT: 15.6 mg
Seed mass max23.2 mg
Seed mass min8.68 mg
Life cycle & reproduction37
After harvest regrowth rateSlow
Bloom periodLate Spring
Coppice potentialNo
DeciduousnessN
⚠ sources differ — TRY: N · GIFT: deciduous
Dehiscencedehiscent
Dispersal typeanimal
Flower colourred
Flower conspicuousYes
Flowering endJul
Flowering startMay
Flowering timeyynnnnnnyyyy
Fruit seed period beginSummer
Fruit seed period endFall
Growth rate USDAModerate
Life formperennial
Life spanperennial
Lifespan categoryModerate
Lifespan years6 years
Pollination modebiotic
Pollination syndromeinsect
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Resprout abilityNo
Seed number112
Seed spread rateSlow
Seedling vigorHigh
Self fertilizationabsent
Vegetative spread rateNone
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment28
Active growth periodSpring and Summer
Adapted to coarse textured soilsNo
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerModerate
Foliage porosity winterPorous
Foliage textureMedium
Fruit colourbrown
Fruit typelegume_indehiscent
⚠ sources differ — AusTraits: legume_indehiscent · GIFT: berry
Growth formherb
Growth form USDASingle Crown
Hedge toleranceNone
Known allelopathNo
Leaf compoundnesscompound
Leaf retentionNo
Leaf shapeelliptical linear oblong
Low growing grassNo
Mycorrhiza typearbuscular
Root depth min14 in
Shape and orientationErect
Small grainNo
Woodinessnon-woody
Physiology & chemistry26
Anaerobic toleranceNone
C:N ratioMedium
Caco3 toleranceHigh
Cold stratification requiredNo
Drought toleranceHigh
Fertility requirementMedium
Fire resistantNo
Fire toleranceHigh
Frost free days min95 days
Leaf C:N ratio13.94 g/g
Leaf c462 mg/g
Leaf dry-matter content (LDMC)253 mg/g
Leaf n37.17 mg/g
Moisture useLow
Nitrogen fixation levelMedium
Photosynthetic pathwayC3
Precipitation max45 in
Precipitation min11 in
Protein potentialHigh
Salinity toleranceLow
Seed longevity index0
Shade toleranceHigh
Soil pH max8.5 pH
Soil pH min6 pH
Specific leaf area (SLA)12.87 mm²/mg
⚠ sources differ — TRY: 12.87 mm²/mg · LEDA: 18.2 mm²/mg · GIFT: 18.59 mm²/mg
Temperature min-38 °F
Uses & economy15
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productYes
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable browse animalMedium
Palatable graze animalHigh
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound30 240 per lb
ToxicityNone
Veneer productNo
Other traits5
Diaspore typeone-seeded generative dispersule
Fall conspicuousNo
Fruit seed abundanceHigh
Fruit seed conspicuousNo
Fruit seed persistenceNo
03Chemical composition83 compounds
Compounds documented for Onobrychis viciifolia across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Cinnamic acids and derivatives36
Flavonols34
Flavones4
Chalcones4
Flavan-3-ols4
Documented compounds83 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (2R)-2-[(E)-3-(4-hydroxyphenyl)prop-2-enoyl]oxybutanedioic acid | present | LOTUS | |
| (2r)-5-Hydroxy-2-(4-hydroxyphenyl)-7-methoxychroman-4-one | present | NPASS | |
| (3S)-7-hydroxy-3-(2-hydroxy-4-methoxyphenyl)-2,3-dihydrochromen-4-one | present | NPASS | |
| (Z)-1-(2,4-Dihydroxyphenyl)-3-(4-Hydroxyphenyl)Prop-2-En-1-One | present | NPASS | |
| (Z)-3-phenyl-2-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyprop-2-enoic acid | present | LOTUS | |
| 1-(2,4-Dihydroxyphenyl)-3-(4-Hydroxyphenyl)Prop-2-En-1-One | present | LOTUS | |
| 1-Phosphatidyl-D-myo-inositol | present | NPASS | |
| 2-(2-Hydroxy-4-methoxyphenyl)-6-methoxy-5-benzofuranol | present | LOTUS | |
| 2-(3,4-dihydroxyphenyl)-3-[(2S,3R,4R,5R,6S)-4,5-dihydroxy-3-[(2S,3S,4R,5S,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxy-6-[[(2S,3R,4S,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxymethyl]oxan-2-yl]oxy-5,7-dihydroxychromen-4-one | present | LOTUS | |
| 2-(3,4-dihydroxyphenyl)-5-hydroxy-7-[(2R,3S,4R,5R,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-3-[(2R,3S,4R,5R,6S)-3,4,5-trihydroxy-6-[[(2S,3S,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxymethyl]oxan-2-yl]oxychromen-4-one | present | LOTUS |
05DNA & barcoding53 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Onobrychis viciifolia has left across the world's sequence archives.
At a glance
DNA specimens53
Marker genes6
GenBank sequences10
eDNA detections35
Countries7
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGTTGAGGGCACGTCTGCCTGGGCGTCACATATC …
Onobrychis viciifolia isolate OTU_22 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL4★rbcLa★ITS4★ITS2trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT
The complete instruction manual Onobrychis viciifolia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size1 427 880 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Onobrychis viciifolia1.43 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 28 n = 14
Ploidy4× tetraploid · measured
Chromosome records14–282n range28median28mode27records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2826×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl +10
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — CENCI C.A., BASSI G., FERRANTI F., ROMANO B. - 2000. Some morphometric, anatomical and biochemical characteristics of fruits and seeds of Onobrychis spp. in Italy.. Plant Biosystems , 134(1): 91-98.
CCDB · slov-fl — Májovský J. et al., 1974b: Index of chromosome numbers of Slovakian flora Part 4. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 23: 1-23.
CCDB · slov-fl — Májovský J., Uhríková A., Javorčíková D., Mičieta K., Králik E., Dúbravcová Z., Feráková V., Murín A., Černušáková D., Hindáková M., Schwarzová T. & Záborský J., 2000: Prvý doplnok karyotaxonomického prehľadu flóry Slovenska. - Acta Fac. Rerum Nat. Univ. Comen., Bot. Supplementum Nr. 1: 1-127.
CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. IX. Cruciferae Fernandes, A., M. F. Santos & M. Queirs.Bol. Soc. Brot. ser. 251: 137-186(1977).
CCDB · iber-fl — Fitodermologia i cariologia d'Onobrychis viciifolia Scop., O. supina (Chaix)DC. i O. saxatilis Lam. de Catalunya. Garnatje, T. & A. Cardona.Orsis3: 55-65(1988).
CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 691-719. Diosdado, J. C. & al.Lagascalia17(1): 173-184(1993).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=2869
CCDB · fl-europaea — Polya, 1950
CCDB · ipcn-api-dl — Garnatje, T. & A. Cardona. 1988. Fitodermologia i cariologia d'Onobrychis viciifolia Scop., O. supina (Chaix) DC. i O. saxatilis Lam. de Catalunya. Orsis 3: 55–65.
CCDB · ipcn-api-dl — Zhu, B. c., H. c. Zheng, S. z. Zheng & Y. Zhang. 1989. Chromosome observation of eight fabaceous species from northwest China. Pp. 369--373 in D. Hong (editor), Plant Chromosome Research 1987.
CCDB · ipcn-api-dl — Diosdado, J. C., C. Santa-Bárbara, J. Vioque, R. Juan & J. Pastor. 1993. Números cromosomáticos para la flora Española. 691--719. Lagascalia 17: 173–184.
CCDB · ipcn-api-dl — Uhrikova, A. 1974a. In Index to chromosome numbers of Slovakian flora. Part 4. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 23: 1–23.
CCDB · ipcn-api-dl — Uhrikova, A. & T. SCHWARZOVA. 1976. In IOPB chromosome number reports LIII. Taxon 25: 483–500.
CCDB · ipcn-api-dl — Fernandes, A. & M. QUEIROS. 1978. Contribution à la connaissance cytotaxinomique des Spermatophyta du Portugal. IV. Leguminosee (Suppl. 3). Bol. Soc. Brot., sér. 2 52: 79–164.
CCDB · ipcn-api-dl — KOZUHAROV, S., A. Petrova & T. MARKOVA. 1975a. Cytotaxonomic study of Bulgarian Leguminosae species. I. Pp. 31-47 in Bulg. Acad. Sci., In Honour of Acad. D. Jordanov.
CCDB · ipcn-api-dl — BAYKABILOV, T. 1977. Karyosytematics of the Uzbekistan species of the genus Onobrychis. Tashkent. 96 pp.
CCDB · book-ipcn75-78 — Kozuharov et al. 1975a
CCDB · book-ipcn75-78 — Uhrikova 1974a
CCDB · book-ipcn75-78 — Fernandes & Queiros 1978
CCDB · book-ipcn73-74 — KOZUHAROV, S.I., A.V. PETROVA, & T. MARKOVA. 1973. In IOPB chromosome number reports XL. Taxon 22: 285-291.
CCDB · book-ipcn73-74 — MAJOVSKY, J., ET AL. 1974. Index of chromosome numbers of Slovakian Flora. (Part 4). Acta Fac. Rerum Nat. Univ. Comenianae Bot. 23: 1-23.
CCDB · book-atlas-flowering-plants — Maude 1939
CCDB · kew — Hayot C. Personal communication 2010
CCDB · CromoCat 2015 — Castroviejo & al. (2003). Flora Iberica (vol. I-VIII, X, XIV) Publicaciones del CSIC Madrid
2n 141×CCDB · book-atlas-flowering-plants
CCDB · book-atlas-flowering-plants — Po cult
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
tetraploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type91 757 records
Wild obs. + sensor86 802
Museum / vouchered3 030
Cultivated / captive68
Other1 857
Origin
Native2 070
Introduced1 655
Range
Area of Occupancy AOO117 260 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy35% within 1 km
≤100 m 17 165≤1 km 7 371≤10 km 45 702>10 km 596
70 834 georeferenced · 15 968 without coordinates
Open the mapobservation + sensor86 802
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy43% within 1 km
≤100 m 163≤1 km 445≤10 km 750>10 km 51
1 409 georeferenced · 1 621 without coordinates
Open the institutions mapphysical evidence3 030
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
>10 km 5
5 georeferenced · 63 without coordinates
Open the mapnot free-living68
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions102 of 201 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 356 |
| BIO-UNIPIlocation not on record | 279 |
| BFLlocation not on record | 210 |
| Moscow State Universitylocation not on record | 183 |
| LDlocation not on record | 173 |
| Salzburg, AT | 138 |
| MeiseBGlocation not on record | 111 |
| MAlocation not on record | 57 |
| València, ES | 55 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 53 |
| SLU Artdatabankenlocation not on record | 51 |
| Oskarshamn, SE | 44 |
| Provincia di Livornolocation not on record | 33 |
| BDBClocation not on record | 31 |
| BRNUlocation not on record | 30 |
| Görlitz, DE | 29 |
| BClocation not on record | 28 |
| Entomological Society of Latvialocation not on record | 27 |
| Bronx, US | 27 |
| UniKSlocation not on record | 25 |
| Karlsruhe, DE | 23 |
| South Kensington, GB | 23 |
| Museo Entomologico de Leonlocation not on record | 21 |
| Tartu, EE | 20 |
| Bern, CH | 19 |
| ESP004location not on record | 19 |
| Barcelona, ES | 18 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 18 |
| CJBGlocation not on record | 17 |
| Mlocation not on record | 16 |
| Uppsala, SE | 16 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 16 |
| Berlin, DE | 15 |
| Bozeman, US | 14 |
| Logan, US | 14 |
| Vitoria, ES | 12 |
| Frankfurt am Main | 12 |
| SZUlocation not on record | 12 |
| Vancouver, CA | 12 |
| Fulda, DE | 10 |
| WTUlocation not on record | 9 |
| Saint Louis, US | 9 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 9 |
| Pamplona, ES | 9 |
| College of the Atlantic, Museumlocation not on record | 9 |
| CZE096location not on record | 9 |
| Madrid, ES | 9 |
| GJOlocation not on record | 9 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 9 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 9 |
| Denver, US | 9 |
| Brussel, BE | 8 |
| Pullman, US | 8 |
| Wlocation not on record | 8 |
| CICYTEXlocation not on record | 8 |
| PrivatHerblocation not on record | 7 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 7 |
| Caldwell, US | 7 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 7 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 7 |
| Tilburg, NL | 7 |
| Xining, CN | 7 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 7 |
| San Sebastián, ES | 7 |
| Helsinki, FI | 7 |
| Missoula, US | 7 |
| Provo, US | 7 |
| Natural History Museum Rotterdamlocation not on record | 6 |
| Corvallis, US | 6 |
| Boise, US | 6 |
| PRClocation not on record | 6 |
| Victoria, CA | 6 |
| Orem, US | 6 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 6 |
| Claremont, US | 6 |
| Alicante, ES | 6 |
| Uniwersytet Śląski w Katowicachlocation not on record | 6 |
| Yangling, CN | 5 |
| Porrentruy, CH | 5 |
| ASUlocation not on record | 5 |
| Voronezh State Universitylocation not on record | 5 |
| DOI/NPS, Greenbelt Parklocation not on record | 5 |
| Salamanca, ES | 5 |
| Moscow, US | 5 |
| Wuzhou, CN | 5 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 4 |
| Whitehorse, CA | 4 |
| Glarus, CH | 4 |
| Tallinn, EE | 4 |
| IDElocation not on record | 4 |
| DBF-NHMDlocation not on record | 4 |
| Turku, FI | 4 |
| Henderson, US | 4 |
| Pocatello, US | 4 |
| Bourges, FR | 4 |
| EEZA-CSIClocation not on record | 3 |
| Olocation not on record | 3 |
| Sion, CH | 3 |
| Santiago de Compostela, ES | 3 |
| Hobart, AU | 3 |
| NBSIlocation not on record | 3 |
| Université Lavallocation not on record | 3 |
| Kew, GB | 3 |
| Frauenfeld, CH | 3 |
| Pamplona, ES | 3 |
| Winterthur, CH | 3 |
| Chadron, US | 3 |
| Auckland, NZ | 3 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 3 |
| H-Adlerlocation not on record | 3 |
| Dresden, DE | 3 |
| Riverside, US | 3 |
| Nijmegen, NL | 3 |
| National Museum Waleslocation not on record | 3 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 2 |
| OLAlocation not on record | 2 |
| DOI/NPS, Craters of the Moon National Monument & Preservelocation not on record | 2 |
| New Haven, US | 2 |
| Trondheim, NO | 2 |
| Herbarium of South China Botanical Gardenlocation not on record | 2 |
| Córdoba, ES | 2 |
| Zürich, CH | 2 |
| Macomb, US | 2 |
| Armidale, AU | 2 |
| Canadian Department of Agriculturelocation not on record | 2 |
| Uniwersytet Warszawskilocation not on record | 2 |
| University of Stellenboschlocation not on record | 2 |
| US | 2 |
| LfUlocation not on record | 2 |
| SVN019location not on record | 2 |
| Eastern Nevada Landscape Coalitionlocation not on record | 2 |
| Philadelphia, US | 2 |
| Beijing, CN | 2 |
| UGentlocation not on record | 2 |
| Jena Microbial Resource Collectionlocation not on record | 2 |
| Burlington, US | 2 |
| Mount Annan, AU | 2 |
| Chongqing Museumlocation not on record | 2 |
| Bureau of Land Managementlocation not on record | 2 |
| Badajoz, ES | 2 |
| DPIlocation not on record | 2 |
| Québec, CA | 2 |
| Montréal, CA | 1 |
| Pittsburg, US | 1 |
| Museo Achille Folettolocation not on record | 1 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 1 |
| Podgorica, ME | 1 |
| Jyväskylä, FI | 1 |
| Oswego, US | 1 |
| Granada, ES | 1 |
| San Jose, US | 1 |
| Yukon Universitylocation not on record | 1 |
| NMWlocation not on record | 1 |
| CBDClocation not on record | 1 |
| Lausanne, CH | 1 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 1 |
| Christchurch, NZ | 1 |
| Xiamen, CN | 1 |
| IPE-CSIClocation not on record | 1 |
| AUT001location not on record | 1 |
| Taipei, TW | 1 |
| University of British Columbia, Herbariumlocation not on record | 1 |
| European Distributed Institute of Taxonomy (EDIT)location not on record | 1 |
| MKD001location not on record | 1 |
| Emporia, US | 1 |
| Spearfish, US | 1 |
| Bangkok, TH | 1 |
| Toronto, CA | 1 |
| Muséum Henri Lecoqlocation not on record | 1 |
| Research Collection of B. A. Bennettlocation not on record | 1 |
| BSBIlocation not on record | 1 |
| St. Paul, US | 1 |
| Zürich, CH | 1 |
| Uniwersytet Opolskilocation not on record | 1 |
| Weber State Universitylocation not on record | 1 |
| Rocky Mountain Biological Laboratorylocation not on record | 1 |
| Ypsilanti, US | 1 |
| GZUlocation not on record | 1 |
| Trois-Rivières, CA | 1 |
| Stadt Seeland, Ortsteil Gatersleben, DE | 1 |
| München, DE | 1 |
| Phyletisches Museum Jenalocation not on record | 1 |
| Grand Junction, US | 1 |
| Madison, US | 1 |
| University of Nevadalocation not on record | 1 |
| SVK001location not on record | 1 |
| BGBMlocation not on record | 1 |
| RJBJCIlocation not on record | 1 |
| University of Alberta Museumslocation not on record | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| H-Dunkellocation not on record | 1 |
| Universite de Montpellierlocation not on record | 1 |
| Banyoles, ES | 1 |
| Palmerston North, NZ | 1 |
| HUN003location not on record | 1 |
| Adam Mickiewicz University in Poznańlocation not on record | 1 |
| Knoxville, US | 1 |
| Canberra, AU | 1 |
| ROM007location not on record | 1 |
| Clemson, US | 1 |
| ESP109location not on record | 1 |
201 institutions · 2 794 of 3 030 vouchered records shown · 219 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA35 detections
Where the DNA of Onobrychis viciifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found35
Studies independent surveys1
Countries5
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 35 detections have coordinates
Open the map5 countries0
highway gravelUrban parks and large gardens
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median14.9 °C 9.40–21.5
Seasonal swing summer↔winter17.5 °C
Max temp (day)18.3 °C 12.0–26.3
Min temp (night)10.9 °C 4.20–15.5
Precipitation66.0 mm/mo 37.9–120
Air humidity60.1 % 52.0–63.3
Moisture balance-45.1 mm/mo
Vapour deficit660 Pa 477–1,228
Wind speed3.10 m/s
Cloud cover40.2 % 33.1–49.2
CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.