Oncometopia orbona

(Fabricius, 1798) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Cicadellidae/Oncometopia

At a glance

Occurrence records7 734

Data sources8

Biological traits0

DNA specimens6

eDNA detections6

Sources8 archives

Databases and archives Oncometopia orbona's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility7 734 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF7 734 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD6 specimens

Genome at a glanceGoaT · NCBI≈1.5 Gbp

01Narrative

Oncometopia orbona, the broad-headed sharpshooter, is a species of sharpshooter in the family Cicadellidae. Broad-headed sharpshooter, Oncometopia orbona

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Oncometopia orbona has left across the world's sequence archives.

At a glance

DNA specimens6

BINs2

Marker genes1

eDNA detections6

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Diversity (π)0.86%

Haplotypes2

BINs2

Most divergent pair2.6%

Where individuals differ — all 17 variable positions, in barcode order

82Amostly conserved

133Cmostly conserved

139Cmostly conserved

199Amostly conserved

202Gmostly conserved

214Cmostly conserved

274Amostly conserved

283Tmostly conserved

302Tmostly conserved

304Gmostly conserved

316Tmostly conserved

469Tmostly conserved

562Cmostly conserved

616Cmostly conserved

619Amostly conserved

634Tmostly conserved

646Cmostly conserved

AACTCTCTACTTTATATTTGGTATTTGATCAGGAATAGTAGGTATAATATTAAGAATAATTATTCGAATTGAATTAGCCCAACCTGGGCC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Cuerna costalissame family13.1%Cuerna semibulbasame family13.2%Oncometopia nigricanssame genus13.5%Cuerna striatasame family13.6%Cuerna yuccaesame family13.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Oncometopia orbona carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈1 471 404 947 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Oncometopia orbona1.47 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type7 734 records

Wild obs. + sensor7 276

Museum / vouchered458

Origin

Native8

Range

Area of Occupancy AOO17 488 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 3 949≤1 km 933≤10 km 310>10 km 855

6 047 georeferenced · 1 229 without coordinates

Open the mapobservation + sensor7 276

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy35% within 1 km

≤100 m 5≤1 km 52≤10 km 102>10 km 4

163 georeferenced · 295 without coordinates

Open the institutions mapphysical evidence458

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Champaign, US	202
Montgomery, US	160
Grupo Actinomicetales Merida Facultad de Medicinalocation not on record	44
Texas A&M University Insect Collectionlocation not on record	11
University of Delawarelocation not on record	10
Philadelphia, US	8
University Park, US	6
Universidad Católica de Manizaleslocation not on record	4
Washington, US	2
UDlocation not on record	2
San Francisco, US	1
CUlocation not on record	1
Museu Nacional de História Natural e da Ciêncialocation not on record	1

13 institutions · 452 of 458 vouchered records shown · 6 without an institution code

09Environmental DNA6 detections

Where the DNA of Oncometopia orbona was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.2 °C 19.7–24.7

Seasonal swing summer↔winter23.4 °C

Max temp (day)26.8 °C 22.7–30.2

Min temp (night)17.4 °C 16.7–20.2

Precipitation104 mm/mo 98.1–126

Air humidity59.4 % 59.4–60.7

Moisture balance-41.6 mm/mo -63.8–-21.8

Vapour deficit1,022 Pa 905–1,274

Wind speed2.90 m/s 2.50–4.10

Cloud cover36.9 % 35.7–38.9

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Oncometopia orbona

At a glance

Sources8 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type7 734 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions6 of 13 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type7 734 records