Onchocerca volvulus

Leuckart, 1893 · species

image placeholder — illustration coming later

Animalia/Nematoda/Chromadorea/Rhabditida/Onchocercidae/Onchocerca

At a glance

Occurrence records1 619

Data sources9

Biological traits0

DNA specimens18

eDNA detections8

Sources9 archives

Databases and archives Onchocerca volvulus's data was compiled from.

WikipediaWikimedia Foundation8 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 619 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics18 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 619 records

Environmental DNA1 datasets · 2 countries8 detections

DNA & barcodingBOLD18 specimens

Genome at a glanceGoaT · NCBI147 Mbp

01Narrative

Onchocerca volvulus is a filarial (arthropod-borne) nematode (roundworm) that causes onchocerciasis (river blindness), and is the second-leading cause of blindness due to infection worldwide after trachoma. It is one of the 20 neglected tropical diseases listed by the World Health Organization, with elimination from certain countries expected by 2020. John O’Neill, an Irish surgeon, first described Onchocerca volvulus in 1874, when he found it to be the causative agent of ‘craw-craw’, a skin disease found in West Africa. A Guatemalan doctor, Rodolfo Robles, first linked it to visual impairment in 1917. O. volvulus is primarily found in sub-Saharan Africa, and humans are the only known definitive host. It is spread from person to person via female biting blackflies of the genus Simulium.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding18 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Onchocerca volvulus has left across the world's sequence archives.

At a glance

DNA specimens18

BINs1

Marker genes11

eDNA detections8

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P649 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

36Tmostly conserved

61Amostly conserved

529Gmostly conserved

559Gmostly conserved

TTGGATGTTGCCTTTGATGTTGGGGGCTCCTGAGATGGCGTTTCCTCGGGTAAATGCTTTATCTTTTTGGTTTACTTTTGTGGCTTTATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.19%

Haplotypes3

BIN1

Most divergent pair0.31%

OtherAfrica

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Onchocerca ochengisame genus2.2%Onchocerca fasciatasame genus7.4%Onchocerca suzukiisame genus8.3%Onchocerca flexuosasame genus8.8%Dirofilaria ursisame family10.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PCOIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6

animal barcodemitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_001861 ↗ · 12 protein · 22 tRNA · 2 rRNA

ND2ND4COX1ND6CYTBCOX3ND4LND1ATP6COX2ND3ND512S ribosomal RNA16S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Onchocerca volvulus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size146 700 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Onchocerca volvulus0.15 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Ploidy2× diploid · measured

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Blaxter et al. (2023) A catalogue of chromosome counts for Phylum Nematoda Data Files, Mark Blaxter, Darwin Tree of Life

GoaT · Blaxter et al. (2023) A catalogue of chromosome counts for Phylum Nematoda Data Files, Mark Blaxter, Darwin Tree of Life

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

Completeness98% BUSCO

08Occurrence & distribution

Record type1 619 records

Wild obs. + sensor1 586

Museum / vouchered33

Range

Area of Occupancy AOO836 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 2

2 georeferenced · 1 584 without coordinates

Open the mapobservation + sensor1 586

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy73% within 1 km

≤100 m 22≤10 km 7>10 km 1

30 georeferenced · 3 without coordinates

Open the institutions mapphysical evidence33

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mexico City, MX	29
Harold Winfred Manter Laboratory of Parasitologylocation not on record	2
Washington, US	1
Cambridge, US	1

4 institutions · 33 of 33 vouchered records shown

09Environmental DNA8 detections

Where the DNA of Onchocerca volvulus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.9 °C 15.9–23.9

Seasonal swing summer↔winter11.0 °C

Max temp (day)24.4 °C 19.9–28.9

Min temp (night)15.4 °C 11.0–19.8

Precipitation116 mm/mo 64.2–168

Air humidity59.1 % 58.5–59.7

Moisture balance6.40 mm/mo -22.8–35.5

Vapour deficit1,023 Pa 786–1,260

Wind speed1.80 m/s 1.70–1.90

Cloud cover33.6 % 26.8–40.4

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Onchocerca volvulus

At a glance

Sources9 archives

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Sequencing statusassembly quality — how far to trust these numbers

Record type1 619 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions3 of 4 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 619 records