Olearia canescens

(Benth.) Hutch. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Olearia

At a glance

Occurrence records215

Data sources7

Biological traits29

DNA specimens5

eDNA detections4

Sources7 archives

Databases and archives Olearia canescens's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility215 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources29 traits

Occurrence & distributionGBIF215 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI5 specimens

01Narrative

Habit Olearia canescens is a species of flowering plant in the family Asteraceae and is endemic to eastern Australia. It is a shrub with scattered elliptic or egg-shaped leaves, and white and yellow, daisy-like inflorescences.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAusTraitsGIFTTRY

Size & morphology11

Fruit length1.5 mm

Leaf length35 mm

Leaf length max60 mm

Leaf length min10 mm

Leaf width12 mm

Leaf width max21 mm

Leaf width min3 mm

Plant height2 m

Plant height max2 m

Seed length1.25 mm

Seed width1 mm

Life cycle & reproduction7

Dehiscenceindehiscent

Flowering endAug

Flowering startFeb

Flowering timenyyyyyyyyyyn

Life spanperennial

Resprouting capacityresprouts

Sex typegynomonoecious

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typeachene

Growth formshrub

Leaf compoundnesssimple

Leaf shapeelliptical ovate

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Olearia canescens has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes5

GenBank sequences6

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKC242380.1 ↗547 bp

ACGT

ATGGGTTGGGCGTTAGCTCGATCCTCGTGGCACACCGTCGATGTGCGTCCTTGATGACCCTTTGGAATTCTTGGTCGCTGTTTCGACGTA …

Olearia canescens voucher MEL:2361065 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL1★rbcLa★ITS3★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type215 records

Wild obs. + sensor84

Museum / vouchered42

Other89

Origin

Native2

Range

Area of Occupancy AOO644 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 69≤1 km 6≤10 km 3>10 km 1

79 georeferenced · 5 without coordinates

Open the mapobservation + sensor84

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy56% within 1 km

≤100 m 4≤1 km 6≤10 km 7>10 km 1

18 georeferenced · 24 without coordinates

Open the institutions mapphysical evidence42

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	8
Smithfield, AU	6
Kew, GB	5
Museo Entomologico de Leonlocation not on record	4
Canberra, AU	3
Armidale, AU	3
Hobart, AU	2
Mount Annan, AU	2
Adelaide, AU	2
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	1
NSW Office of Environment and Heritagelocation not on record	1
NSW Dept of Planning, Industry and Environmentlocation not on record	1
University of Stellenboschlocation not on record	1
Honolulu, US	1

14 institutions · 40 of 42 vouchered records shown · 2 without an institution code

09Environmental DNA4 detections

Where the DNA of Olearia canescens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.3 °C 18.3–18.3

Seasonal swing summer↔winter14.9 °C

Max temp (day)24.6 °C

Min temp (night)12.1 °C

Precipitation52.7 mm/mo

Air humidity54.6 %

Moisture balance-63.5 mm/mo

Vapour deficit1,003 Pa

Wind speed2.40 m/s

Cloud cover20.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)