Olearia brevipedunculata

N.G.Walsh · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Olearia

At a glance

Occurrence records495

Data sources7

Biological traits22

DNA specimens1

eDNA detections1

Sources7 archives

Databases and archives Olearia brevipedunculata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility495 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources22 traits

Occurrence & distributionGBIF495 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Olearia brevipedunculata, commonly known as the dusty daisy-bush (although this name may also refer to O. phlogopappa), is a small shrub with whitish-grey foliage and white daisy-like flowers in summer. Mostly found in Victoria and scattered locations in New South Wales, Australia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAusTraitsTRYGIFT

Size & morphology10

Fruit length2.5 mm

Leaf length10.75 mm

Leaf mass per area98.72 g/m2

Leaf size15.9 mm²

Leaf width4.25 mm

Plant height1 m

Plant height max1 m

Seed mass0.691 mg

Seed mass max0.69 mg

Seed mass min0.69 mg

Life cycle & reproduction5

Dispersal typewind

Flowering timeynnnnnnnnnyy

Life spanperennial

Pollination syndromeinsect

Resprouting capacityresprouts

Habitat & environment5

Fruit typeachene

Growth formshrub

Leaf compoundnesssimple

Leaf shapeelliptical obovate

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Olearia brevipedunculata has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences2

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSKC242365.1 ↗551 bp

ACGT

ATGGGTTGGGCGTTAGCTCGATTCTCGTGGCACACCGTCGATGTGCGTCCTTGATGACCCATTGGGCTTCTTGGTCGCTTTTTCGACGTA …

Olearia brevipedunculata voucher MEL:2361105 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS1★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type495 records

Wild obs. + sensor350

Museum / vouchered142

Cultivated / captive3

Origin

Native14

Range

Area of Occupancy AOO640 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 252≤1 km 50≤10 km 15>10 km 1

318 georeferenced · 32 without coordinates

Open the mapobservation + sensor350

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy62% within 1 km

≤100 m 36≤1 km 42≤10 km 41>10 km 6

125 georeferenced · 17 without coordinates

Open the institutions mapphysical evidence142

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 3

3 georeferenced

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Canberra, AU	61
Museo Entomologico de Leonlocation not on record	42
Mount Annan, AU	12
Parkville, AU	7
NSW Dept of Planning, Industry and Environmentlocation not on record	4
Adelaide, AU	4
QVMAGlocation not on record	3
La Trobe Universitylocation not on record	3
John T. Waterhouse Herbariumlocation not on record	2
Kensington, AU	2
PRClocation not on record	1
Minia, EG	1

12 institutions · 142 of 142 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Olearia brevipedunculata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)