Olearia ballii

(F.Muell.) F.Muell. ex Hemsl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Olearia

At a glance

Occurrence records58

Data sources7

Biological traits22

DNA specimens2

eDNA detections2

Sources7 archives

Databases and archives Olearia ballii's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility58 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources22 traits

Occurrence & distributionGBIF58 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Olearia ballii là một loài thực vật có hoa trong họ Cúc. Loài này được (F.Muell.) F.Muell. ex Hemsl. mô tả khoa học đầu tiên năm 1896.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFT

Size & morphology7

Fruit length3 mm

Leaf length8.5 mm

Leaf length max12 mm

Leaf length min5 mm

Leaf width1 mm

Plant height1.25 m

Plant height max1.5 m

Life cycle & reproduction4

Flowering endMar

Flowering startNov

Life spanperennial

Sex typegynomonoecious

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typeachene

Growth formshrub

Leaf compoundnesssimple

Leaf shapelinear

Woodinesswoody

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Olearia ballii has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences2

eDNA detections2

The DNA barcodea real sequence read deposited for this species

ITSAF497662.1 ↗631 bp

ACGT

TCGAAGCCTGCAAAGCAGAACGACCTGTGAACATGTTATAACAACCATGCCAGGATGGGTTGGGTGTTGGCTCGATCCTCGTGGCACACC …

Olearia ballii internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2★ITS2

fungal barcode

08Occurrence & distribution

Record type58 records

Wild obs. + sensor11

Museum / vouchered47

Origin

Native11

Range

Area of Occupancy AOO40 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 9≤1 km 1

10 georeferenced · 1 without coordinates

Open the mapobservation + sensor11

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy69% within 1 km

≤100 m 4≤1 km 23≤10 km 12

39 georeferenced · 8 without coordinates

Open the institutions mapphysical evidence47

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo Entomologico de Leonlocation not on record	13
Mount Annan, AU	11
Canberra, AU	11
Wellington, NZ	2
John T. Waterhouse Herbariumlocation not on record	2
Hobart, AU	1
Brisbane, AU	1
NSW Dept of Planning, Industry and Environmentlocation not on record	1
Auckland, NZ	1
Adelaide, AU	1
University of Alberta Museumslocation not on record	1

11 institutions · 45 of 47 vouchered records shown · 2 without an institution code

09Environmental DNA2 detections

Where the DNA of Olearia ballii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)