Olearia argophylla

(Labill.) F.Muell. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Olearia

At a glance

Occurrence records1 925

Data sources10

Biological traits44

DNA specimens1

eDNA detections1

Sources10 archives

Databases and archives Olearia argophylla's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 925 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources44 traits

Chemical compositionLOTUS2 compounds

Occurrence & distributionGBIF1 925 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceGoaTgenome

01Narrative

Botanical specimen from 1806 Olearia argophylla, commonly known as musk daisy-bush, native musk or silver shrub, is a species of flowering plant in the family Asteraceae and is endemic to south-eastern Australia. It is a shrub or tree with silvery branchlets, egg-shaped to elliptic leaves, and white and yellow, daisy-like inflorescences.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAusTraitsTRYGIFT

Size & morphology18

Fruit length2 mm

Leaf length103 mm

Leaf length max184 mm

Leaf length min15 mm

Leaf mass270 mg

Leaf mass per area105 g/m2

Leaf size3 459 mm²

Leaf width37 mm

Leaf width max90 mm

Leaf width min10 mm

Petiole length2.5 cm

Plant height10 m

Plant height max10 m

Seed length1.5 mm

Seed mass0.45 mg

⚠ sources differ — TRY: 0.45 mg · AusTraits: 0.579 mg · GIFT: 0.445 mg

Seed mass max0.57 mg

Seed mass min0.32 mg

Seed width1 mm

Life cycle & reproduction12

Deciduousnessevergreen

Dehiscenceindehiscent

Dispersal typewind

Flowering endApr

Flowering startSep

Flowering timeyyyynnnnyyyy

Life spanperennial

Lifespan years175 years

Pollination syndromeinsect

Reproductive maturity3 years

Resprouting capacityresprouts

Sex typehermaphrodite+monoecious

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typeachene

Growth formshrub

⚠ sources differ — GIFT: shrub · AusTraits: tree · TRY: woody

Leaf compoundnesssimple

Leaf shapewidely_elliptical

Woodinesswoody

Physiology & chemistry4

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)8.72 mm²/mg

Wood density696 mg/cm³

03Chemical composition2 compounds

Compounds documented for Olearia argophylla across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Simple coumarins2

Documented compounds2 total

Tissue Source Quantified only

Compound	Class	Amount	Source
(+)-Epoxysuberosin		present	LOTUS
Meranzin		present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Olearia argophylla has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences2

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSAF247064.1 ↗622 bp

ACGT

TCGAAGCCTGCAAAGCAGAACGACCCGTGAACATGTTATAACAACCATGTGCCAGGAGGGTCAGGCATCAGTTTGATCCTCGTGGCACAC …

Olearia argophylla internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2

fungal barcode

06Genome at a glanceGoaT

The complete instruction manual Olearia argophylla carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Ploidypolyploid inferred

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 925 records

Wild obs. + sensor1 920

Museum / vouchered5

Range

Area of Occupancy AOO2 860 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 1 062≤1 km 152≤10 km 58>10 km 47

1 319 georeferenced · 601 without coordinates

Open the mapobservation + sensor1 920

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced · 3 without coordinates

Open the institutions mapphysical evidence5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Honolulu, US	2
Cincinnati, US	1
University of Alberta Museumslocation not on record	1
BAYLUlocation not on record	1

4 institutions · 5 of 5 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Olearia argophylla was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Olearia argophylla

At a glance

Sources10 archives

Size & morphology18

Life cycle & reproduction12

Diet & foraging1

Habitat & environment9

Physiology & chemistry4

Compound class profile1 class

Documented compounds2 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 925 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions2 of 4 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type1 925 records