Olearia arborescens

(G.Forst.) Cockayne & Laing · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Olearia

At a glance

Occurrence records1 827

Data sources10

Biological traits6

DNA specimens2

eDNA detections3

Sources10 archives

Databases and archives Olearia arborescens's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 827 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources6 traits

Occurrence & distributionGBIF1 827 records

Environmental DNA2 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 108

01Narrative

Olearia arborescens, also known as common tree daisy is a common shrub or small tree of New Zealand. It grows in lowland to alpine scrubland in the North Island from East Cape southwards, and throughout the South and Stewart Islands. The leaves of the plant are wide, oval-shaped, wavy and toothed, and are greyish underneath. O. arborescens produces white bunched flowers in spring to summer. Olearia arborescens in flower

No narrative description available for this taxon yet.

02Traits & measurements

SourcesTRYGIFT

Life cycle & reproduction2

Deciduousnessevergreen

Life spanperennial

Habitat & environment2

Growth formtree

⚠ sources differ — GIFT: tree · TRY: shrub

Woodinesswoody

Physiology & chemistry2

Leaf n17.74 mg/g

Leaf p1.74 mg/g

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Olearia arborescens has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences3

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAY193801.1 ↗630 bp

ACGT

TCGAAGCCTGCAAAGCAGAACGACCCGTGAACATGTTATAACAACCACGTGCCAGGAGGGTCGGGCGTCAGTCAGATCCTCGGGCCACGC …

Olearia arborescens internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★ITS2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Olearia arborescens carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 108 n = 54

Ploidypolyploid inferred

Chromosome records108–1082n range108median108mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 1082×CCDB · new-zealand · CCDB · ipcn-api-dl

CCDB · new-zealand

CCDB · ipcn-api-dl — Beuzenberg, E. J. & J. B. Hair. 1984. Contributions to a chromosome atlas of the New Zealand flora - 27: Compositae. New Zealand J. Bot. 22: 353–356.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 827 records

Wild obs. + sensor1 370

Museum / vouchered457

Origin

Native2

Range

Area of Occupancy AOO3 068 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 797≤1 km 227≤10 km 70>10 km 28

1 122 georeferenced · 248 without coordinates

Open the mapobservation + sensor1 370

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy44% within 1 km

≤100 m 2≤1 km 9≤10 km 9>10 km 5

25 georeferenced · 432 without coordinates

Open the institutions mapphysical evidence457

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Christchurch, NZ	196
Wellington, NZ	144
Auckland, NZ	74
Rotorua, NZ	24
Hobart, AU	3
Palmerston North, NZ	3
Claremont, US	2
Mount Annan, AU	2
Moscow State Universitylocation not on record	1
John T. Waterhouse Herbariumlocation not on record	1
SNSNMClocation not on record	1
University of Alberta Museumslocation not on record	1
Smithfield, AU	1
Canberra, AU	1

14 institutions · 454 of 457 vouchered records shown · 3 without an institution code

09Environmental DNA3 detections

Where the DNA of Olearia arborescens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys2

Countries1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

Australasia

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.0 °C 16.0–16.0

Seasonal swing summer↔winter0.9 °C

Max temp (day)19.5 °C

Min temp (night)12.5 °C

Precipitation448 mm/mo

Air humidity73.9 %

Moisture balance335 mm/mo

Vapour deficit475 Pa

Wind speed0.7 m/s

Cloud cover50.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Olearia arborescens

At a glance

Sources10 archives

Life cycle & reproduction2

Habitat & environment2

Physiology & chemistry2

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 827 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 14 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 827 records