Olearia alpicola — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Olearia

At a glance

Occurrence records3

Data sources5

Biological traits33

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Olearia alpicola's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources33 traits

Occurrence & distributionGBIF3 records

DNA & barcodingNCBIsequences

01Narrative

Olearia alpicola, commonly known as alpine daisy bush, is a shrub in the family Asteraceae and is found in mountainous terrain in New South Wales and Victoria in Australia. A small shrub with spreading branches and white daisy-like inflorescences.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAusTraitsTRYGIFT

Size & morphology11

Fruit length2.75 mm

Leaf length129 mm

Leaf length max129 mm

Leaf length min25 mm

Leaf width12 mm

Leaf width max23 mm

Leaf width min3 mm

Petiole length1.2 cm

Plant height2 m

Plant height max2.5 m

Seed mass0.941 mg

Life cycle & reproduction9

Dehiscenceindehiscent

Dispersal typewind

Flowering endFeb

Flowering startDec

Flowering timeyynnnnnnnnny

Life spanperennial

Pollination syndromeinsect

Resprouting capacityresprouts

Sex typegynomonoecious

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typeachene

Growth formshrub

Leaf compoundnesssimple

Leaf shapeovate

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Olearia alpicola has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

rbcLMW229247.1 ↗152 036 bp

ACGT

ATGGGCGAACGACGGGAATTGAACCCGCGCATGGTGGATTCACAATCCACTGCCTTGATCCACTTGGCTACATCCGCCCCTCTACTATTA …

Olearia alpicola chloroplast, partial genome

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

rbcL1

plant barcode

08Occurrence & distribution

Record type3 records

Wild obs. + sensor3

Range

Area of Occupancy AOO12 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced · 1 without coordinates

Open the mapobservation + sensor3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.