Olearia algida

N.A.Wakef. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Olearia

At a glance

Occurrence records1 062

Data sources9

Biological traits42

DNA specimens1

eDNA detections1

Sources9 archives

Databases and archives Olearia algida's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 062 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources42 traits

Occurrence & distributionGBIF1 062 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Olearia algida, the alpine daisy-bush is a species of flowering plant in the family Asteraceae and is endemic to south-eastern Australia. It is a shrub with small, crowded, elliptic to narrow egg-shaped leaves with the narrower end towards the base and heads of white and cream-coloured, daisy-like flowers.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAusTraitsTRYGIFT

Size & morphology16

Fruit length1.5 mm

Leaf length3 mm

Leaf length max3 mm

Leaf length min1 mm

Leaf mass per area101 g/m2

Leaf size2.22 mm²

Leaf width1 mm

Leaf width max1 mm

Leaf width min0.5 mm

Plant height0.7 m

⚠ sources differ — AusTraits: 0.7 m · TRY: 0.232 m

Plant height max0.7 m

Seed length1.5 mm

Seed mass0.199 mg

⚠ sources differ — TRY: 0.199 mg · AusTraits: 0.495 mg · GIFT: 0.199 mg

Seed mass max0.199 mg

Seed mass min0.199 mg

Seed width0.5 mm

Life cycle & reproduction11

Dehiscenceindehiscent

Dispersal typewind

Flowering endApr

Flowering startOct

Flowering timeyyyynnnnnyyy

Life span>50

⚠ sources differ — TRY: >50 · AusTraits: perennial · GIFT: perennial

Lifespan years50 years

Pollination syndromeinsect

Reproductive maturity2 years

Resprouting capacityfire_killed

Sex typehermaphrodite+monoecious

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typeachene

Growth formshrub

Leaf compoundnesssimple

Leaf shapeelliptical narrowly_obovate

Woodinesswoody

Physiology & chemistry4

Leaf dry-matter content (LDMC)350 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)9.88 mm²/mg

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Olearia algida has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSKC242400.1 ↗552 bp

ACGT

ATGGGTTGGGTGTTAGCTCGATCCTCGTGGCACACCGTGATGTGCGTCCTTGATGACCCATTGGGGCTTCTTGGTTGCTGTTTTGACGTA …

Olearia algida voucher MEL:2361228 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1★ITS2

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Olearia algida carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 181×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Beuzenberg, E. J. & J. B. Hair. 1984. Contributions to a chromosome atlas of the New Zealand flora - 27: Compositae. New Zealand J. Bot. 22: 353–356.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 062 records

Wild obs. + sensor776

Museum / vouchered280

Cultivated / captive6

Origin

Native52

Range

Area of Occupancy AOO1 680 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 574≤1 km 86≤10 km 62>10 km 5

727 georeferenced · 49 without coordinates

Open the mapobservation + sensor776

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy48% within 1 km

≤100 m 29≤1 km 88≤10 km 111>10 km 14

242 georeferenced · 38 without coordinates

Open the institutions mapphysical evidence280

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 6

6 georeferenced

Open the mapnot free-living6

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo Entomologico de Leonlocation not on record	70
Hobart, AU	60
Mount Annan, AU	52
Canberra, AU	46
QVMAGlocation not on record	13
Adelaide, AU	11
John T. Waterhouse Herbariumlocation not on record	6
Parkville, AU	4
Armidale, AU	4
Kew, GB	3
NSW Dept of Planning, Industry and Environmentlocation not on record	2
Kensington, AU	2
La Trobe Universitylocation not on record	2
Stockholm, SE	1
Davis, US	1
Wollongong, AU	1
Christchurch, NZ	1
University of Alberta Museumslocation not on record	1

18 institutions · 280 of 280 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Olearia algida was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Olearia algida

At a glance

Sources9 archives

Size & morphology16

Life cycle & reproduction11

Diet & foraging1

Habitat & environment9

Physiology & chemistry4

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 062 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions12 of 18 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type1 062 records