Olea capensis

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Oleaceae/Olea

At a glance

Occurrence records710

Data sources9

Biological traits39

DNA specimens9

eDNA detections18

Sources9 archives

Databases and archives Olea capensis's data was compiled from.

GBIFGlobal Biodiversity Information Facility710 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI18 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

PloiDBPloidy Databasegenome & karyotype

Paleobiology DatabasePBDB consortiumfossil record↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources39 traits

Chemical compositionNPASS11 compounds

Occurrence & distributionGBIF710 records

Environmental DNA1 datasets · 5 countries18 detections

DNA & barcodingBOLD · NCBI9 specimens

Genome at a glanceGoaTgenome

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology15

Fruit length15.5 mm

Fruit width13.9 mm

Leaf length0 mm

Leaf width0 mm

Plant height19.67 m

Plant height max30 m

Plant height min0.5 m

Seed length9.2 mm

Seed mass266 mg

Seed mass max274 mg

Seed mass min258 mg

Seed volume245 mm³

Seed volume max290 mm³

Seed volume min200 mm³

Seed width max6 mm

Life cycle & reproduction6

Deciduousnessevergreen

Dehiscenceindehiscent

Dispersal typeanimal

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max2 075 m

Elevation min5 m

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typedrupe

Growth formtree

Woodinesswoody

Physiology & chemistry5

Leaf n13.78 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)4.91 mm²/mg

Wood density766 mg/cm³

Other traits2

Leaf thickness0.029 mm

Seed height max6 mm

03Chemical composition11 compounds

Compounds documented for Olea capensis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Flavanones2

Quinoline alkaloids1

Limonoids1

Lupane triterpenoids1

Minor lignans1

Documented compounds11 total

Tissue Source Quantified only

Compound	Amount	Source
(2R)-2-(2-phenylethyl)-2,3-dihydrochromen-4-one	present	NPASS
1,5-Diphenylpentan-3-ol	present	NPASS
8-Methoxy-2-(2-phenylethyl)-4H-1-benzopyran-4-one	present	NPASS
beta-Sitosterol	present	NPASS
Carpachromene	present	NPASS
Hesperidin	present	NPASS
Lupeol	present	NPASS
methyl (2S)-2-acetyloxy-2-[(1S,5S,6R,7R,8R,9S,10R,11S,14R)-7,8-diacetyloxy-5-(furan-3-yl)-6,10,12,12,14-pentamethyl-16-methylidene-3-oxo-4,13,15-trioxatetracyclo[7.6.1.01,6.010,14]hexadecan-11-yl]acetate	present	NPASS
NKZHPGOWVWDIJW-AUDXBFFCSA-N	present	NPASS
Skimmianine	present	NPASS

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Olea capensis has left across the world's sequence archives.

At a glance

DNA specimens9

Marker genes4

GenBank sequences10

eDNA detections18

Countries5

The DNA barcodea real sequence read deposited for this species

ITSLN515405.1 ↗763 bpSouth Africa

ACGT

GTCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCCGCA …

Olea capensis subsp. capensis genomic DNA containing 18S rRNA gene, ITS1, 5.8S rRNA gene, ITS2 and 28S rRNA gene, specimen voucher Costa 3 (MPU)

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL4★rbcLa★ITS3

plant barcodefungal barcode

06Genome at a glanceGoaT

The complete instruction manual Olea capensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Ploidypolyploid inferred

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type710 records

Wild obs. + sensor541

Museum / vouchered154

Other15

Origin

Native7

Range

Area of Occupancy AOO1 332 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 381≤1 km 51≤10 km 26>10 km 4

462 georeferenced · 79 without coordinates

Open the mapobservation + sensor541

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 2≤10 km 1>10 km 1

4 georeferenced · 150 without coordinates

Open the institutions mapphysical evidence154

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
TAFORI-LSRClocation not on record	75
Kew, GB	15
National Herbarium of São Tomé and Principelocation not on record	7
National Museums of Kenyalocation not on record	6
Stockholm, SE	6
BRLUlocation not on record	6
Saint Louis, US	5
Felix d'Herelle Reference Center for Bacterial Viruseslocation not on record	4
University of Johannesburglocation not on record	3
Paris, FR	2
Coimbra, PT	2
Brussels, BE	2
Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record	1
Bronx, US	1
MAlocation not on record	1
Bloomington, US	1
Moscow State Universitylocation not on record	1
Uppsala, SE	1
University of Stellenboschlocation not on record	1
Glocation not on record	1
Dekalb, US	1
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1
Monastir, TN	1
Philadelphia, US	1

24 institutions · 145 of 154 vouchered records shown · 9 without an institution code

09Environmental DNA18 detections

Where the DNA of Olea capensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found18

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 18 detections have coordinates

Open the map5 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.4 °C 14.4–20.8

Seasonal swing summer↔winter7.50 °C

Max temp (day)23.4 °C 18.4–26.9

Min temp (night)12.9 °C 10.2–16.6

Precipitation95.1 mm/mo 30.8–163

Air humidity58.7 % 48.3–61.6

Moisture balance-33.9 mm/mo -98.6–34.0

Vapour deficit870 Pa 636–1,202

Wind speed2.80 m/s 2.50–3.50

Cloud cover18.2 % 15.0–27.0

CHELSA 1981–2010, ~9 km grid, at location & month of 15 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)