Oldenlandia umbellata

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Rubiaceae/Oldenlandia

At a glance

Occurrence records103

Data sources11

Biological traits11

DNA specimens2

eDNA detections2

Sources11 archives

Databases and archives Oldenlandia umbellata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility103 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Paleobiology DatabasePBDB consortiumfossil record↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Chemical compositionLOTUS · NPASS15 compounds

Occurrence & distributionGBIF103 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 36

01Narrative

Oldenlandia umbellata là một loài thực vật có hoa trong họ Thiến thảo. Loài này được L. mô tả khoa học đầu tiên năm 1753.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formannual or subshrub

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

Other traits1

Plant support typefree-standing

03Chemical composition15 compounds

Compounds documented for Oldenlandia umbellata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Anthraquinones and anthrones5

Megastigmanes4

Apocarotenoids (β-)1

Documented compounds15 total

Tissue Source Quantified only

Compound	Amount	Source
(2R,3R,4S,5S,6R)-2-[(1S,4S,5R)-4-hydroxy-4-[(E,3S)-3-hydroxybut-1-enyl]-3,3,5-trimethylcyclohexyl]oxy-6-(hydroxymethyl)oxane-3,4,5-triol	present	NPASS
1,2-Dimethoxyanthracene-9,10-Dione	present	LOTUS
1,3-Dimethoxy-2-hydroxy-9,10-anthraquinone	present	LOTUS
4-[(4R,6S)-4-hydroxy-2,6-dimethyl-6-[[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxymethyl]cyclohexen-1-yl]butan-2-one	present	NPASS
7-Megastigmene-3,5,6,9-tetraol	present	NPASS
AJXYNZCNGHTKHQ-NBBQBKSFSA-N	present	NPASS
Alizarin	present	LOTUS
Alizarin 1-methyl ether	present	LOTUS
Corchoionoside C	present	NPASS
HLMBNQSAJFYETD-LRLXOWGESA-N	present	NPASS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Oldenlandia umbellata has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes1

GenBank sequences2

eDNA detections2

Countries2

The DNA barcodea real sequence read deposited for this species

ITSHE657770.1 ↗644 bpIndia · 2009

ACGT

GGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAATCCTGCAAACAACCGCGAACACGTTTCATGA …

Oldenlandia umbellata genomic DNA containing ITS1, 5.8S rRNA gene, ITS2, specimen voucher ODU:Suman Neupane 84

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Oldenlandia umbellata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 36 n = 18

Ploidypolyploid inferred

Chromosome records36–362n range36median36mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 363×CCDB · ipcn-api-dl · CCDB · book-atlas-flowering-plants

CCDB · ipcn-api-dl — Selvaraj, R. 1987. Karyomorphological studies in south Indian Rubiaceae. Cytologia 52: 343–356.

CCDB · book-atlas-flowering-plants

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type103 records

Wild obs. + sensor84

Museum / vouchered19

Range

Area of Occupancy AOO88 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 11

11 georeferenced · 73 without coordinates

Open the mapobservation + sensor84

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 7

7 georeferenced · 12 without coordinates

Open the institutions mapphysical evidence19

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pondicherry, IN	13
San Jose State University, Museum of Birds and Mammalslocation not on record	1
McWane Science Centerlocation not on record	1
Universität Göttingenlocation not on record	1

4 institutions · 16 of 19 vouchered records shown · 3 without an institution code

09Environmental DNA2 detections

Where the DNA of Oldenlandia umbellata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)