Oenothera glaucifolia

W.L.Wagner & Hoch · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Onagraceae/Oenothera

At a glance

Occurrence records1 648

Data sources10

Biological traits12

DNA specimens5

eDNA detections3

Sources10 archives

Databases and archives Oenothera glaucifolia's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 648 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Chemical compositionLOTUS4 compounds

Occurrence & distributionGBIF1 648 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceCCDB2n = 14

01Narrative

Stenosiphon linifolius là một loài thực vật có hoa trong họ Anh thảo chiều. Loài này được Heynh. miêu tả khoa học đầu tiên năm 1840.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass1.72 mg

Seed mass max1.72 mg

Seed mass min1.72 mg

Life cycle & reproduction2

Life formbiennial

Life spanperennial

Habitat & environment4

Climatetemperate

Climberself-supporting

Growth formSubshrub, Forb/herb

Woodinessvariable

Physiology & chemistry3

Leaf c409 mg/g

Leaf n21.22 mg/g

Specific leaf area (SLA)16.23 mm²/mg

03Chemical composition4 compounds

Compounds documented for Oenothera glaucifolia across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Flavonols4

Documented compounds4 total

Tissue Source Quantified only

Compound	Amount	Source
Afzelin	present	LOTUS
Myricetin 3-glucoside	present	LOTUS
Myricitrin	present	LOTUS
Quercitrin	present	LOTUS

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Oenothera glaucifolia has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes4

GenBank sequences7

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOL537489.1 ↗336 bpUSA · 2019

ACGT

TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCTAAGCCATTTGGCCGAGGGCACGTCTGCCTGGGCGTCAATCATC …

Oenothera glaucifolia voucher BRIT:Gostel491 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2★ITS4★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Oenothera glaucifolia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Chromosome records14–142n range14median14mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 143×CCDB · book-fedorov

CCDB · book-fedorov — Johansen 1929b

CCDB · book-fedorov — Gregory D. P., Klein 1960

CCDB · book-fedorov — Kurabayashi et al. 1962

n 71×CCDB · Cave1962

CCDB · Cave1962 — Kurabayashi et al. 1962

08Occurrence & distribution

Record type1 648 records

Wild obs. + sensor1 314

Museum / vouchered334

Range

Area of Occupancy AOO3 148 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 784≤1 km 108≤10 km 56>10 km 40

988 georeferenced · 326 without coordinates

Open the mapobservation + sensor1 314

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy21% within 1 km

≤100 m 5≤1 km 47≤10 km 142>10 km 55

249 georeferenced · 85 without coordinates

Open the institutions mapphysical evidence334

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Wuzhou, CN	237
Austin, US	30
Emporia, US	21
Chadron, US	13
Saint Louis, US	11
University of Stellenboschlocation not on record	7
Fort Worth, US	5
San Angelo, US	2
GB	1
BAYLUlocation not on record	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1
Jackson, US	1
Provo, US	1
Dekalb, US	1

14 institutions · 332 of 334 vouchered records shown · 2 without an institution code

09Environmental DNA3 detections

Where the DNA of Oenothera glaucifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.9 °C 26.9–26.9

Seasonal swing summer↔winter21.6 °C

Max temp (day)31.9 °C

Min temp (night)22.4 °C

Precipitation109 mm/mo

Air humidity56.9 %

Moisture balance-71.9 mm/mo

Vapour deficit1,529 Pa

Wind speed3.10 m/s

Cloud cover31.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Oenothera glaucifolia

At a glance

Sources10 archives

Size & morphology3

Life cycle & reproduction2

Habitat & environment4

Physiology & chemistry3

Compound class profile1 class

Documented compounds4 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 648 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 14 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 648 records