Oeneis alberta

Elwes, 1893 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Nymphalidae/Oeneis

At a glance

Occurrence records1 494

Data sources6

Biological traits0

DNA specimens50

eDNA detections0

Sources6 archives

Databases and archives Oeneis alberta's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 494 records↗

BOLD SystemsCentre for Biodiversity Genomics50 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 494 records

DNA & barcodingBOLD50 specimens

01Narrative

Oeneis alberta, the Alberta Arctic, is a butterfly of the family Nymphalidae. It is found from the Canadian prairie provinces east to southern Manitoba. Isolated populations are found along the Rocky Mountains in Colorado, New Mexico and Arizona.Butterflies and Moths of North America The wingspan is 35–57 mm. The upperside is light yellow grey while the underside is light brown. Adults are on wing from May to June in one generation per year. The larvae feed on bunch grass, possibly Festuca species. The species overwinters in the larval stage.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding50 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Oeneis alberta has left across the world's sequence archives.

At a glance

DNA specimens50

BINs1

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus36 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 8 variable positions, in barcode order

181Gvariable

184Gvariable

271Cvariable

298Cvariable

335Avariable

565Gmostly conserved

571Cvariable

628Avariable

AACTTTATATTTTATTTTAGGAATTTGAGCAGGTATAGTAGGAACATCTCTTAGTCTTATTATTCGAACAGAATTAGGTAACCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.63%

Haplotypes11

BIN1

Most divergent pair1.5%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Oeneis ammonsame genus3.5%Oeneis macouniisame genus3.5%Oeneis rosovisame genus4.3%Oeneis horasame genus4.9%Oeneis mullasame genus4.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 494 records

Wild obs. + sensor294

Museum / vouchered760

Other440

Range

Area of Occupancy AOO900 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 94≤1 km 134≤10 km 27>10 km 14

269 georeferenced · 25 without coordinates

Open the mapobservation + sensor294

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy21% within 1 km

≤100 m 1≤1 km 19≤10 km 54>10 km 21

95 georeferenced · 665 without coordinates

Open the institutions mapphysical evidence760

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
OSUClocation not on record	568
New Haven, US	50
University of Alberta Museums (UAM)location not on record	44
Royal Saskatchewan Museumlocation not on record	32
Denver, US	22
Toronto, CA	15
Philadelphia, US	6
King Saud Universitylocation not on record	6
Washington, US	5
Tartu, EE	3
Cleveland Museum of Natural History, OH (CLEV)location not on record	2
KWPlocation not on record	2
Awka, NG	1
Natural History Museum of Utahlocation not on record	1
Laboratorium voor Microbiologie der Landbouwhogeschoollocation not on record	1
Georgia Museum of Natural Historylocation not on record	1

16 institutions · 759 of 760 vouchered records shown · 1 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Oeneis alberta

At a glance

Sources6 archives

At a glance

Record type1 494 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions7 of 16 geolocated

Record type1 494 records