Octopus vulgaris

Cuvier, 1797 · species

image placeholder — illustration coming later

Animalia/Mollusca/Cephalopoda/Octopoda/Octopodidae/Octopus

At a glance

Occurrence records20 716

Data sources14

Biological traits0

DNA specimens753

eDNA detections578

Sources14 archives

Databases and archives Octopus vulgaris's data was compiled from.

Animal Diversity WebUniv. of Michigan MZspecies account↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility16 289 records↗

OBISOcean Biodiversity Information System4 427 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI578 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics753 specimens↗

FooDBThe Metabolomics Innovation Centrecompounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeADWarticle

Chemical compositionFooDB · NPASS156 compounds

Occurrence & distributionGBIF · OBIS20 716 records

Environmental DNA1 datasets · 13 countries578 detections

DNA & barcodingBOLD753 specimens

Genome at a glanceGoaT · NCBI5 Gbp

01Narrative

Reach 1-3 feet in length including arms. The skin is smooth. Like other octopuses, members of this species have 8 arms that are lined with suckers, and they lack any internal shell.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition156 compounds

Compounds documented for Octopus vulgaris across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

🍽 Used in cookingAquatic foods

Compound class profile5 classes

Aminoacids41

Unsaturated fatty acids21

Carbazole alkaloids20

Branched fatty acids $ Unsaturated fatty acids16

Pyridine alkaloids15

Documented compounds156 total

Tissue Source Quantified only

Compound	Amount	Source
Cholesterol	210,000 mg/100 g	FooDB
L-Glutamic acid	4,056 mg/100g	FooDB
L-Aspartic acid	2,877 mg/100g	FooDB
Nitrogen	2,600 mg/100 g	FooDB
epsilon-Polylysine	2,228 mg/100g	FooDB
Arginine	2,176 mg/100g	FooDB
L-Leucine	2,099 mg/100g	FooDB
Glycine	1,866 mg/100g	FooDB
L-Alanine	1,804 mg/100g	FooDB

05DNA & barcoding753 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Octopus vulgaris has left across the world's sequence archives.

At a glance

DNA specimens753

BINs8

Marker genes11

eDNA detections578

Countries25

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus694 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 33 variable positions, in barcode order

1Cvariable

13Cmostly conserved

79Amostly conserved

110Tvariable

157Tmostly conserved

178Tmostly conserved

187Tmostly conserved

250Cmostly conserved

259Cmostly conserved

265Cmostly conserved

271Tmostly conserved

280Cmostly conserved

304Tmostly conserved

313Avariable

316Tmostly conserved

343Amostly conserved

376Cmostly conserved

391Amostly conserved

427Tmostly conserved

442Cvariable

496Tmostly conserved

508Gmostly conserved

517Tmostly conserved

542Cmostly conserved

559Cmostly conserved

589Cmostly conserved

604Cmostly conserved

607Amostly conserved

619Amostly conserved

634Cvariable

641Cmostly conserved

646Tmostly conserved

653Cmostly conserved

CACACTATACTTCATTTTTGGAATTTGATCAGGACTTTTAGGTACCTCCTTAAGTTTAATAATTCGAACAGAACTAGGACAACCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.1%

Haplotypes21

BINs7

Most divergent pair3.8%

EuropeAsiaOtherAfricaN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Octopus sinensissame genus2.5%Octopus jollyorumsame genus2.5%Octopus americanussame genus2.6%Octopus tetricussame genus3.2%Octopus hummelinckisame genus10.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PCOIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6

animal barcodemitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_006353 ↗ · 13 protein · 22 tRNA · 2 rRNA

COX3ND3ND2COX1COX2ATP8ATP6ND5ND4ND4LCYTBND6ND1l-rRNAs-rRNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Octopus vulgaris carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size5 036 700 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Octopus vulgaris5.04 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness73% BUSCO

08Occurrence & distribution

Record type20 716 records

Wild obs. + sensor13 780

Museum / vouchered2 093

Other4 843

Origin

Native914

Range

Area of Occupancy AOO20 236 km²

Depth

0–200 m sunlit2 539

200–1000 m twilight97

1–4 km midnight2

>4 km abyssal0

median 61.9 m · max 1 864 m · 2 638 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 3 256≤1 km 3 137≤10 km 539>10 km 204

7 136 georeferenced · 6 644 without coordinates

Open the mapobservation + sensor13 780

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy12% within 1 km

≤100 m 4≤1 km 55≤10 km 52>10 km 370

481 georeferenced · 1 612 without coordinates

Open the institutions mapphysical evidence2 093

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 39 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Istituto Superiore per la Protezione e la Ricerca Ambientalelocation not on record	376
ICATMARlocation not on record	163
Washington, US	133
UM-RSMASlocation not on record	75
National Marine Biodiversity Institute of Korealocation not on record	24
Cambridge, US	18
South Kensington, GB	16
North Carolina Museum of Natural Scienceslocation not on record	16
Philadelphia, US	14
Museu Nacional de História Natural e da Ciêncialocation not on record	13
CASlocation not on record	13
Museu Nacional/Universidade Federal do Rio de Janeirolocation not on record	12
Texas Cooperative Wildlife Collectionlocation not on record	10
Florida Atlantic University, Harbor Branch Oceanographic Museumlocation not on record	10
Florida Fish and Wildlife Conservation Commission, Fish and Wildlife Research Institutelocation not on record	9
Alabama Museum of Natural Historylocation not on record	9
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	7
New Haven, US	6
Natural History Museum Rotterdamlocation not on record	5
Santa Barbara Museum of Natural Historylocation not on record	4
Barcelona, ES	4
Toyama, JP	3
Sam Noble Oklahoma Museum of Natural Historylocation not on record	3
PUC-RSlocation not on record	3
The Atlantic reference Centrelocation not on record	3
Frankfurt am Main	3
Chicago, US	3
IEO-COMA-CSIClocation not on record	2
Earth Sciences New Zealandlocation not on record	2
Paris, FR	1
Stockholm, SE	1
Chongqing Museumlocation not on record	1
Instituto de Investigaciones Marinas y Costeras (INVEMAR)location not on record	1
Museo de Biologia de la Universidad Central de Venezuelalocation not on record	1
Delaware Museum of Nature and Sciencelocation not on record	1
Toyohashi Museum Of Natural Historylocation not on record	1
Brussels, BE	1
ICM-CSIClocation not on record	1
South African Institute for Aquatic Biodiversitylocation not on record	1

39 institutions · 969 of 2 093 vouchered records shown · 461 without an institution code

09Environmental DNA578 detections

Where the DNA of Octopus vulgaris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found578

Studies independent surveys1

Countries13

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 578 detections have coordinates

Open the map13 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.8 °C 10.4–20.6

Seasonal swing summer↔winter6.40 °C

Max temp (day)18.9 °C 15.7–21.2

Min temp (night)16.9 °C 3.20–20.1

Precipitation23.7 mm/mo 1.00–148

Air humidity66.1 % 54.3–79.2

Vapour deficit635 Pa 444–786

Cloud cover39.0 % 15.5–44.7

CHELSA 1981–2010, ~9 km grid, at location & month of 230 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Octopus vulgaris

At a glance

Sources14 archives

Compound class profile5 classes

Documented compounds156 total

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type20 716 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions12 of 39 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type20 716 records