Octopus briareus

G.C.Robson, 1929 · species

image placeholder — illustration coming later

Animalia/Mollusca/Cephalopoda/Octopoda/Octopodidae/Octopus

At a glance

Occurrence records848

Data sources10

Biological traits8

DNA specimens13

eDNA detections11

Sources10 archives

Databases and archives Octopus briareus's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

Animal Diversity WebUniv. of Michigan MZspecies account↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility697 records↗

OBISOcean Biodiversity Information System151 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeADW · Wikipediaarticle

Traits & measurements1 literature sources8 traits

Occurrence & distributionGBIF · OBIS848 records

Environmental DNA1 datasets · 3 countries11 detections

DNA & barcodingBOLD13 specimens

01Narrative

The Caribbean reef octopus (Octopus briareus) is a coral reef marine animal. It has eight long arms that vary in length and diameter. The mantle is large and chunky in comparison (up to 60 cm long). This species is difficult to describe because it changes color and texture to blend into its surroundings, using specialised skin cells known as chromatophores. Its color range is very large; it can change from crimson to green, and bumpy to smooth. It weighs around 3.3 lb or 1.5 kg.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology2

Body length100 cm

Body mass1 500 g

Habitat & environment2

Habitat saltwateryes

Habitat zonereef-associated

Uses & economy1

Commercial importancecommercial

Other traits3

Depth max20 m

Depth min0 m

Vulnerability60

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Octopus briareus has left across the world's sequence archives.

At a glance

DNA specimens13

BINs1

Marker genes1

eDNA detections11

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P611 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

162Tmostly conserved

183Amostly conserved

304Gmostly conserved

451Cmostly conserved

483Cvariable

502Cmostly conserved

510Avariable

GGTTTGTTAGGAACCTCCTTAAGTTTAATAATCCGAACAGAATTAGGACAACCTGGTTCCCTCCTTAATGATGATCAACTATATAATGTA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.39%

Haplotypes4

BIN1

Most divergent pair0.65%

N.AmericaS.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Octopus americanussame genus12.7%Octopus tetricussame genus13.1%Octopus tagangasame genus13.3%Octopus bockisame genus13.4%Octopus sinensissame genus13.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type848 records

Wild obs. + sensor502

Museum / vouchered346

Origin

Native1

Range

Area of Occupancy AOO1 712 km²

Depth

0–200 m sunlit76

200–1000 m twilight1

1–4 km midnight0

>4 km abyssal0

median 46.7 m · max 448 m · 77 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 248≤1 km 109≤10 km 47>10 km 31

435 georeferenced · 67 without coordinates

Open the mapobservation + sensor502

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy60% within 1 km

≤100 m 1≤1 km 31≤10 km 12>10 km 9

53 georeferenced · 293 without coordinates

Open the institutions mapphysical evidence346

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
UM-RSMASlocation not on record	56
Washington, US	52
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	8
Santa Barbara Museum of Natural Historylocation not on record	8
Cambridge, US	5
Alabama Museum of Natural Historylocation not on record	5
Philadelphia, US	4
Florida Atlantic University, Harbor Branch Oceanographic Museumlocation not on record	4
Florida Fish and Wildlife Conservation Commission, Fish and Wildlife Research Institutelocation not on record	3
CASlocation not on record	3
North Carolina Museum of Natural Scienceslocation not on record	2
The University of the West Indies, Trinidad and Tobagolocation not on record	1
FCMMlocation not on record	1
Texas Cooperative Wildlife Collectionlocation not on record	1
Delaware Museum of Nature and Sciencelocation not on record	1

15 institutions · 154 of 346 vouchered records shown · 64 without an institution code

09Environmental DNA11 detections

Where the DNA of Octopus briareus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map3 countries0

Marine

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.6 °C 11.7–25.8

Seasonal swing summer↔winter3.60 °C

Max temp (day)29.6 °C 14.5–29.6

Min temp (night)22.3 °C 9.20–23.0

Precipitation222 mm/mo 88.5–222

Air humidity64.7 %

Moisture balance67.7 mm/mo -19.7–67.7

Vapour deficit1,175 Pa 484–1,184

Wind speed2.60 m/s 2.60–4.40

Cloud cover68.7 % 43.8–68.7

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)