Ochrosia borbonica

J.F.Gmel. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Apocynaceae/Ochrosia

At a glance

Occurrence records565

Data sources8

Biological traits21

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Ochrosia borbonica's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility565 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources21 traits

Chemical compositionLOTUS3 compounds

Occurrence & distributionGBIF565 records

DNA & barcodingNCBIsequences

01Narrative

Ochrosia borbonica is a species of plant in the family Apocynaceae. It is native to Mauritius and Réunion, and naturalized in Guangdong Province in China.Kew World Checklist of Selected Plant FamiliesFlora of China Vol. 16 Page 163 玫瑰树 mei gui shu Ochrosia borbonica J. F. Gmelin, Syst. Nat. 2: 439. 1796. The species is listed as endangered.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology9

Fruit length45 mm

Fruit length max45 mm

Fruit length min45 mm

Leaf length115 mm

Leaf length max150 mm

Leaf length min80 mm

Leaf width max50 mm

Leaf width min30 mm

Plant height8 m

Life cycle & reproduction3

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

Other traits1

Plant support typefree-standing

03Chemical composition3 compounds

Compounds documented for Ochrosia borbonica across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Corynanthe type1

Corynanthe type $ Yohimbine-like alkaloids1

Carboline alkaloids1

Documented compounds3 total

Tissue Source Quantified only

Compound	Amount	Source
(13R,14E)-14-Ethylidene-12-methylidene-1,10-diazatetracyclo[11.2.2.03,11.04,9]heptadeca-3(11),4,6,8-tetraene	present	LOTUS
Cabucine	present	LOTUS
Ellipticine	present	LOTUS

05DNA & barcoding4 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ochrosia borbonica has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences4

The DNA barcodea real sequence read deposited for this species

ITSKX689312.1 ↗395 bp

ACGT

TTTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCAGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCTCCCCACGCCTCGAC …

Ochrosia borbonica isolate OCBO3 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★ITS3

plant barcodefungal barcode

08Occurrence & distribution

Record type565 records

Wild obs. + sensor554

Museum / vouchered11

Range

Area of Occupancy AOO120 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤10 km 550>10 km 4

554 georeferenced

Open the mapobservation + sensor554

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced · 9 without coordinates

Open the institutions mapphysical evidence11

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Moscow State Universitylocation not on record	2
Guangzhou, CN	2
South Kensington, GB	1

3 institutions · 5 of 11 vouchered records shown · 6 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)