Ochlodes ochracea

(Bremer, 1861) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Hesperiidae/Ochlodes

At a glance

Occurrence records802

Data sources8

Biological traits0

DNA specimens11

eDNA detections7

Sources8 archives

Databases and archives Ochlodes ochracea's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility802 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF802 records

Environmental DNA1 datasets · 0 countries7 detections

DNA & barcodingBOLD11 specimens

Genome at a glanceGoaT2n = 48

01Narrative

Ochlodes ochracea is a Palearctic butterfly in the Hesperiidae (Hesperiinae). It is found in Amur, Southeast China and Japan. The larva feeds on Carex, Calamagrostis and Brachypodium species.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ochlodes ochracea has left across the world's sequence archives.

At a glance

DNA specimens11

BINs3

Marker genes1

eDNA detections7

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 91% of positions are identical in every specimen.

Where individuals differ — all 61 variable positions, in barcode order

4Tmostly conserved

38Cvariable

40Amostly conserved

48Cmostly conserved

49Cmostly conserved

50Tmostly conserved

51Tmostly conserved

53Amostly conserved

54Gmostly conserved

58Amostly conserved

59Tmostly conserved

61Gvariable

62Amostly conserved

63Tmostly conserved

65Cmostly conserved

66Gmostly conserved

68Amostly conserved

69Cmostly conserved

70Tmostly conserved

71Gmostly conserved

72Amostly conserved

74Tmostly conserved

75Tmostly conserved

77Gmostly conserved

78Gmostly conserved

79Amostly conserved

80Amostly conserved

81Amostly conserved

82Tmostly conserved

83Cmostly conserved

84Cmostly conserved

86Gmostly conserved

87Gmostly conserved

88Amostly conserved

90Cmostly conserved

91Tmostly conserved

92Tmostly conserved

94Amostly conserved

95Amostly conserved

96Tmostly conserved

99Gmostly conserved

100Tmostly conserved

169Tmostly conserved

181Gmostly conserved

217Gmostly conserved

220Tvariable

229Amostly conserved

259Tvariable

278Tmostly conserved

289Amostly conserved

340Cmostly conserved

343Cmostly conserved

355Amostly conserved

370Amostly conserved

421Cmostly conserved

433Gmostly conserved

457Cvariable

508Amostly conserved

553Tmostly conserved

565Avariable

616Cvariable

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATACTAGGAACTTCCTTAAGATTATTGATTCGTACTGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.4%

Haplotypes6

BINs3

Most divergent pair2.3%

AsiaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Lon hobomoksame family6.2%Polites othosame family6.8%Polites premnassame family6.8%Ochlodes subhyalinasame genus7.0%Lon melanesame family7.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Ochlodes ochracea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 48 n = 24

Chromosome records24–482n range36median48mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 241×GoaT · de Vos et al. 2020

GoaT · de Vos et al. 2020 — ↗

2n 291×GoaT · de Vos et al. 2020

GoaT · de Vos et al. 2020 — ↗

2n 481×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

08Occurrence & distribution

Record type802 records

Wild obs. + sensor81

Museum / vouchered721

Range

Area of Occupancy AOO1 716 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 21≤1 km 9≤10 km 4>10 km 8

42 georeferenced · 39 without coordinates

Open the mapobservation + sensor81

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤1 km 12≤10 km 10>10 km 8

30 georeferenced · 691 without coordinates

Open the institutions mapphysical evidence721

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Iwate Prefectural Museumlocation not on record	236
Chiba, JP	79
Tomioka, JP	61
RCMlocation not on record	44
Gifu prefectural Museumlocation not on record	43
Toyota city nature sanctuarylocation not on record	38
Nagatoro-machi, Chichibu-gun, JP	27
Sagamihara, JP	24
Bando, JP	24
Sanda, JP	22
Toyama, JP	20
Helsinki, FI	18
JP	16
Tartu, EE	12
Obihiro Centennial City Museumlocation not on record	11
Yamaguchi-shi, JP	9
Shiojiri City Museum of Natural Historylocation not on record	9
Sam Noble Oklahoma Museum of Natural Historylocation not on record	7
Saga Prefectural Space and Science Museumlocation not on record	5
KOMlocation not on record	4
KIRMlocation not on record	3
Kawasaki Shi Tama Ku, JP	3
Tokushima, JP	2
Cambridge, US	1
Laboratorium voor Microbiologie der Landbouwhogeschoollocation not on record	1
Oiso Municipal Museumlocation not on record	1

26 institutions · 720 of 721 vouchered records shown · 1 without an institution code

09Environmental DNA7 detections

Where the DNA of Ochlodes ochracea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)