Ochina ptinoides

(Marsham, 1802) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Ptinidae/Ochina

At a glance

Occurrence records4 069

Data sources7

Biological traits2

DNA specimens38

eDNA detections33

Sources7 archives

Databases and archives Ochina ptinoides's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 069 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI33 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics38 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF4 069 records

Environmental DNA1 datasets · 4 countries33 detections

DNA & barcodingBOLD38 specimens

01Narrative

Ochina ptinoides is a species of beetles in the genus Ochina of the family Ptinidae.GBIFBiolibInvertebrated Online

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)does not feed

Feeding guild (larval)xylophagous

05DNA & barcoding38 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ochina ptinoides has left across the world's sequence archives.

At a glance

DNA specimens38

BINs1

Marker genes3

eDNA detections33

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus28 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

172Tvariable

200Avariable

AACACTTTATTTCATTTTTGGAGCATGATCAGGAATAGTAGGAACTTCACTTAGAATACTAATTCGATCCGAATTAGGGAACCCCGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.17%

Haplotypes5

BIN1

Most divergent pair0.46%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agonum canadensesame order15.0%Dermestes coarctatussame order15.0%Omophron dentatumsame order15.2%Aleochara thoracicasame order15.5%Phytosus spinifersame order15.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type4 069 records

Wild obs. + sensor3 283

Museum / vouchered379

Fossil21

Other386

Origin

Native97

Range

Area of Occupancy AOO6 400 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy53% within 1 km

≤100 m 1 214≤1 km 288≤10 km 1 238>10 km 89

2 829 georeferenced · 454 without coordinates

Open the mapobservation + sensor3 283

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy13% within 1 km

≤100 m 13≤1 km 30≤10 km 268>10 km 12

323 georeferenced · 56 without coordinates

Open the institutions mapphysical evidence379

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 28 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bern, CH	60
Geneva, CH	50
Paro, BT	37
Zürich, CH	25
Muzeum Górnośląskie w Bytomiulocation not on record	20
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	13
Museum zu Allerheiligen Schaffhausenlocation not on record	12
South Kensington, GB	10
ZSMlocation not on record	8
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	8
SLU Artdatabankenlocation not on record	7
Tilburg, NL	6
CBDClocation not on record	5
Provincia di Livornolocation not on record	4
Museo civico Brancaleoni di Piobbicolocation not on record	4
NCMGlocation not on record	4
Copenhagen, DK	4
Natural History Museum Rotterdamlocation not on record	3
Natural History Museum, Londonlocation not on record	3
Salzburg, AT	2
Fribourg, CH	2
Naturama Aargaulocation not on record	2
Frauenfeld, CH	2
Naturalis Biodiversity Centerlocation not on record	1
Office National des Forets, Laboratoire National d'Entomologie Forestierelocation not on record	1
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1
MZLUlocation not on record	1

28 institutions · 296 of 379 vouchered records shown · 83 without an institution code

09Environmental DNA33 detections

Where the DNA of Ochina ptinoides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found33

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 33 detections have coordinates

Open the map4 countries0

im Wald14. Artificial - Terrestrial | 14.5 Urban Ar…in einem Garten in einer Lichtfalle

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.0 °C 12.1–17.5

Seasonal swing summer↔winter12.9 °C

Max temp (day)18.5 °C 15.0–21.2

Min temp (night)10.1 °C 7.80–13.4

Precipitation52.4 mm/mo 46.4–104

Air humidity60.3 % 58.9–62.5

Moisture balance-46.5 mm/mo -68.4–1.70

Vapour deficit663 Pa 560–788

Wind speed3.20 m/s 2.40–4.30

Cloud cover37.3 % 35.0–43.0

CHELSA 1981–2010, ~9 km grid, at location & month of 31 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ochina ptinoides

At a glance

Sources7 archives

Diet & foraging2

At a glance

Record type4 069 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 28 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 069 records