Occidozyga lima

(Gravenhorst, 1829) · species

image placeholder — illustration coming later

Animalia/Chordata/Amphibia/Anura/Dicroglossidae/Occidozyga

At a glance

Occurrence records1 497

Data sources9

Biological traits10

DNA specimens20

eDNA detections12

Sources9 archives

Databases and archives Occidozyga lima's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 497 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics20 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

Amphibian Species of the WorldAMNHamphibian catalog↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources10 traits

Occurrence & distributionGBIF1 497 records

Environmental DNA1 datasets · 2 countries12 detections

DNA & barcodingBOLD20 specimens

Genome at a glanceGoaT2n = 26

01Narrative

The green puddle frog, rough-skinned floating frog, pearly skin puddle frog, or pointed-tongued floating frog (Occidozyga lima) is a species of frog in the family Dicroglossidae. It is found in Bangladesh, Cambodia, China, Hong Kong, India, Indonesia, Laos, Malaysia, Myanmar, Thailand, Vietnam, and possibly Nepal. Its natural habitats are subtropical or tropical seasonally wet or flooded lowland grassland, rivers, swamps, intermittent freshwater lakes, freshwater marshes, intermittent freshwater marshes, ponds, irrigated land, seasonally flooded agricultural land, and canals and ditches. These frogs are also founded in the pet trade. O. lima may actually consist of separate species, with Chan (2013) arguing for 3 separate species: (1) Java, Indonesia; (2) southern China to northern Indochina; (3) southern Indochina to Myanmar.Chan, H. [陳翰奇]. (2013). Phylogeography and cryptic diversity of Occidozyga lima (Gravenhorst 1829). (Thesis). University of Hong Kong, Pokfulam, Hong Kong SAR. Retrieved from https://dx.doi.org/10.5353/th_b5060583

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAmphiBIO

Size & morphology1

SVL4 cm

Life cycle & reproduction3

Litter size max708

Litter size min707

Reproductive output1 /year

Habitat & environment2

Habitat aquaticyes

Habitat fossorialyes

Other traits4

Activity nocturnalyes

Offspring size max1 mm

Offspring size min1 mm

Repro larvalyes

05DNA & barcoding20 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Occidozyga lima has left across the world's sequence archives.

At a glance

DNA specimens20

BINs4

Marker genes2

eDNA detections12

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 85% of positions are identical in every specimen.

Where individuals differ — all 100 variable positions, in barcode order

2Tmostly conserved

7Tmostly conserved

8Cmostly conserved

19Gmostly conserved

31Amostly conserved

37Avariable

40Cmostly conserved

43Amostly conserved

46Cmostly conserved

49Tmostly conserved

61Tmostly conserved

73Gvariable

82Gmostly conserved

85Tvariable

88Gvariable

94Cvariable

97Tmostly conserved

103Cvariable

106Gmostly conserved

118Tmostly conserved

127Amostly conserved

133Cmostly conserved

136Amostly conserved

139Tvariable

157Gvariable

170Tvariable

172Amostly conserved

178Cvariable

184Tvariable

187Cmostly conserved

199Avariable

203Cmostly conserved

205Gmostly conserved

214Gmostly conserved

217Amostly conserved

220Avariable

223Tmostly conserved

244Tmostly conserved

250Gmostly conserved

268Cmostly conserved

271Amostly conserved

274Tmostly conserved

280Tmostly conserved

283Gvariable

286Gmostly conserved

298Tmostly conserved

301Gvariable

307Amostly conserved

310Gmostly conserved

319Gmostly conserved

325Gvariable

328Gmostly conserved

337Cmostly conserved

340Gvariable

344Tmostly conserved

349Cmostly conserved

352Avariable

361Tvariable

367Gmostly conserved

370Cvariable

383Tmostly conserved

388Tmostly conserved

397Avariable

409Cmostly conserved

415Gmostly conserved

424Cmostly conserved

427Amostly conserved

433Tmostly conserved

439Tmostly conserved

448Cvariable

454Cvariable

457Cvariable

460Tmostly conserved

469Tvariable

478Cmostly conserved

484Gvariable

490Gvariable

497Tvariable

499Amostly conserved

505Cvariable

508Amostly conserved

517Amostly conserved

526Tvariable

535Amostly conserved

538Tmostly conserved

541Gvariable

556Tmostly conserved

565Tvariable

568Tvariable

575Cmostly conserved

578Cvariable

586Tmostly conserved

593Tmostly conserved

616Tmostly conserved

622Avariable

625Tvariable

631Cmostly conserved

637Cmostly conserved

640Gmostly conserved

643Tvariable

CTTATATCTAATTTTTGGGGCCTGGGCCGGAATAGTAGGCACAGCCCTTAGCCTTCTTATTCGGGCGGAATTGAGCCAACCGGGTACGTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)5.3%

Haplotypes5

BINs4

Most divergent pair8.9%

Asia

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P16S

animal barcoderibosomal

06Genome at a glanceGoaT

The complete instruction manual Occidozyga lima carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 26 n = 13

Chromosome records26–262n range26median26mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 263×GoaT · Animal Chromosome Counts Database · GoaT · Amphibian Karyotype Database

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Amphibian Karyotype Database — ↗

07Deep time~37.1 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin37.1 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type1 497 records

Wild obs. + sensor192

Museum / vouchered1 305

Origin

Native2

Range

Area of Occupancy AOO1 260 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy70% within 1 km

≤100 m 77≤1 km 34≤10 km 14>10 km 33

158 georeferenced · 34 without coordinates

Open the mapobservation + sensor192

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy10% within 1 km

≤100 m 34≤1 km 30≤10 km 578>10 km 14

656 georeferenced · 649 without coordinates

Open the institutions mapphysical evidence1 305

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Ann Arbor, US	497
CASlocation not on record	238
Washington, US	172
Toronto, CA	118
North Carolina Museum of Natural Scienceslocation not on record	97
Berkeley, US	87
Wuzhou, CN	24
Cambridge, US	12
Brussels, BE	9
RBINS-Scientific Heritagelocation not on record	7
München, DE	7
Stockholm, SE	6
	4
Chengdu Institute of Biologylocation not on record	3
South Kensington, GB	3
UBCBBMlocation not on record	1
IGRlocation not on record	1
ASUlocation not on record	1

18 institutions · 1 287 of 1 305 vouchered records shown · 18 without an institution code

09Environmental DNA12 detections

Where the DNA of Occidozyga lima was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.1 °C 25.2–28.2

Seasonal swing summer↔winter3.50 °C

Max temp (day)29.0 °C 27.8–31.3

Min temp (night)22.6 °C 22.6–24.4

Precipitation342 mm/mo 136–485

Air humidity69.7 % 61.6–74.0

Moisture balance200 mm/mo -11.4–354

Vapour deficit1,069 Pa 830–1,409

Wind speed2.00 m/s 1.90–4.00

Cloud cover69.8 % 59.0–70.9

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Occidozyga lima

At a glance

Sources9 archives

Size & morphology1

Life cycle & reproduction3

Habitat & environment2

Other traits4

At a glance

Chromosomes & ploidyhow the DNA is packaged

At a glance

When this lineage existed

Record type1 497 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 18 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 497 records