Notiophilus aestuans

Dejean, 1826 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Carabidae/Notiophilus

At a glance

Occurrence records804

Data sources8

Biological traits2

DNA specimens11

eDNA detections10

Sources8 archives

Databases and archives Notiophilus aestuans's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility804 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF804 records

Environmental DNA1 datasets · 2 countries10 detections

DNA & barcodingBOLD11 specimens

01Narrative

Notiophilus aestuans is a species of ground beetle native to Europe.Fauna EuropaeaCarl H. Lindroth 1974 Coleoptera. Carabidae. Handbooks for the Identification of British Insects Vol 4 Part 2. Royal Entomological Society,London pdf

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)predator

Feeding guild (larval)predator

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Notiophilus aestuans has left across the world's sequence archives.

At a glance

DNA specimens11

BINs1

Marker genes1

eDNA detections10

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.15%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 4 variable positions, in barcode order

82Cmostly conserved

340Tmostly conserved

466Amostly conserved

628Amostly conserved

AACTTTATACTTTATTTTTGGAGCTTGATCAGGAATAGTGGGAACTTCTTTAAGAATACTAATTCGAGCAGAATTAGGAAACCCAGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Notiophilus novemstriatussame genus7.0%Notiophilus semiopacussame genus7.1%Notiophilus directussame genus7.4%Notiophilus sylvaticussame genus7.4%Notiophilus borealissame genus8.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type804 records

Wild obs. + sensor496

Museum / vouchered304

Cultivated / captive4

Origin

Native84

Range

Area of Occupancy AOO1 800 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy58% within 1 km

≤100 m 147≤1 km 131≤10 km 198

476 georeferenced · 20 without coordinates

Open the mapobservation + sensor496

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy44% within 1 km

≤100 m 45≤1 km 77≤10 km 144>10 km 12

278 georeferenced · 26 without coordinates

Open the institutions mapphysical evidence304

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 4 records without

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	98
Zürich, CH	55
Bern, CH	21
Forschungsinstitut für biologischen Landbau Frick \| Research Institute of Organic Agriculture Fricklocation not on record	16
Copenhagen, DK	11
Uniwersytet Wrocławskilocation not on record	10
Natural History Museum Rotterdamlocation not on record	9
MZLUlocation not on record	4
Geneva, CH	3
Philadelphia, US	3
NTNU-VMlocation not on record	3
SFRAlocation not on record	2
ZSMlocation not on record	2
Tartu, EE	2
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	2
TMPMlocation not on record	2
Naturmuseum Solothurnlocation not on record	2
CBDClocation not on record	1
Tilburg, NL	1
Bavarian State Collection of Zoologylocation not on record	1
Tallinn, EE	1
Helsinki, FI	1
Private Collection of Dominik Rabllocation not on record	1
ZAF-UMUlocation not on record	1

24 institutions · 252 of 304 vouchered records shown · 52 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA10 detections

Where the DNA of Notiophilus aestuans was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map2 countries0

PionierrasenLaubwaldStreuobstwiese

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.2 °C 8.00–18.3

Seasonal swing summer↔winter17.9 °C

Max temp (day)21.2 °C 11.0–22.7

Min temp (night)12.1 °C 4.80–14.2

Precipitation57.7 mm/mo 48.1–75.2

Air humidity60.1 % 58.1–64.5

Moisture balance-52.3 mm/mo

Vapour deficit808 Pa 383–885

Wind speed3.60 m/s

Cloud cover37.7 % 32.4–47.1

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)