Nothotsuga longibracteata

(W.C.Cheng) H.H.Hu ex C.N.Page · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Pinopsida/Pinales/Pinaceae/Nothotsuga

At a glance

Occurrence records31

Data sources11

Biological traits12

DNA specimens11

eDNA detections10

Sources11 archives

Databases and archives Nothotsuga longibracteata's data was compiled from.

WikipediaWikimedia Foundation11 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility31 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources12 traits

Occurrence & distributionGBIF31 records

Environmental DNA1 datasets · 1 countries10 detections

DNA & barcodingBOLD · NCBI11 specimens

Genome at a glanceCCDB2n = 24

01Narrative

Nothotsuga is a genus of coniferous trees in the family Pinaceae endemic to China. Nothotsuga contains only one species, Nothotsuga longibracteata, commonly known as the bristlecone hemlock, which is found in southeastern China, in southern Fujian, northern Guangdong, northeast Guangxi, northeast Guizhou, and southwest Hunan.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Life cycle & reproduction3

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry2

Photosynthetic pathwayC3

Wood density661 mg/cm³

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Nothotsuga longibracteata has left across the world's sequence archives.

At a glance

DNA specimens11

Marker genes4

GenBank sequences8

eDNA detections10

Countries1

The DNA barcodea real sequence read deposited for this species

ITSEF395456.1 ↗1 710 bp

ACGT

ACAGTGGGGGATCATCGATCCCCTCTTGTGTGGGGGCGTCGATGGCCGTGGCCCATGCCCACTGGAAGGGTGCTCGGATTCGTCGTGGGT …

Nothotsuga longibracteata voucher PE LuoZC-002 clone 47 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL4★ITS1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Nothotsuga longibracteata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 241×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Li, L. c. 1991. The karyotype analysis of Tsuga longibracteata and its taxonomic significance. Acta Bot. Yunnan. 13(3): 309–313.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type31 records

Wild obs. + sensor3

Museum / vouchered25

Cultivated / captive3

Range

Area of Occupancy AOO60 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤1 km 2≤10 km 1

3 georeferenced

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 25 records without

Open the institutions mapphysical evidence25

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 3 records without

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beijing, CN	16
Kew, GB	3
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Guilin, CN	1
Herbarium of South China Botanical Gardenlocation not on record	1
Helsinki, FI	1
Edinburgh, GB	1

7 institutions · 24 of 25 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA10 detections

Where the DNA of Nothotsuga longibracteata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.6 °C 11.5–23.6

Seasonal swing summer↔winter28.1 °C

Max temp (day)22.1 °C 17.0–27.2

Min temp (night)12.2 °C 4.90–19.4

Precipitation123 mm/mo 35.6–210

Air humidity54.8 % 47.5–62.1

Moisture balance9.20 mm/mo -74.3–92.8

Vapour deficit990 Pa 860–1,120

Wind speed3.10 m/s 2.00–4.20

Cloud cover33.0 % 25.9–40.1

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)