Notelaea longifolia

Vent. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Oleaceae/Notelaea

At a glance

Occurrence records10 099

Data sources10

Biological traits44

DNA specimens5

eDNA detections2

Sources10 archives

Databases and archives Notelaea longifolia's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility10 099 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources44 traits

Occurrence & distributionGBIF10 099 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceCCDB2n = 46

01Narrative

Notelaea longifolia is a very common shrub or small tree in eastern Australia. Occurring in or adjacent to rainforest from Mimosa Rocks National Park (37° S) to Bamaga (11° S) in far north Queensland. Common names include large mock-olive or long-leaved-olive. An attractive ornamental plant.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology16

Fruit length13 mm

Fruit width10 mm

Leaf length97.5 mm

Leaf length max160 mm

Leaf length min35 mm

Leaf mass221 mg

Leaf mass per area110 g/m2

Leaf size2 752 mm²

Leaf width33 mm

Leaf width max56 mm

Leaf width min10 mm

Petiole length1 cm

Plant height9 m

Plant height max9 m

Seed length9 mm

Seed width6 mm

Life cycle & reproduction10

Deciduousnessevergreen

Dehiscenceindehiscent

Dispersal typeanimal

Flowering timennnyyyyyyynn

Life formshrub or tree

Life spanperennial

Pollination syndromeinsect

Raunkiær life formphanerophyte

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typedrupe

Growth formtree

Leaf compoundnesssimple

Leaf shapenarrowly_lanceolate widely_ovate

Woodinesswoody

Physiology & chemistry6

Leaf n6.9 mg/g

Leaf p0.293 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)5.64 mm²/mg

Wood density870 mg/cm³

Other traits1

Plant support typefree-standing

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Notelaea longifolia has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes5

GenBank sequences5

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKM895584.1 ↗553 bpAustralia

ACGT

AAGTGTTGGATTCAAAGCGGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGAATACGAAACCAAAGATACTGATATCTTGGCAGC …

Notelaea longifolia voucher 129308711 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★matK2★rbcL3★rbcLatrnH-psbA

animal barcodeplant barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Notelaea longifolia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 46 n = 23

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 231×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — BRIGGS, B.G. 1970. Some chromosome numbers in the Oleaceae. Contr. New South Wales Natl. Herb. 4: 126-129.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type10 099 records

Wild obs. + sensor9 161

Museum / vouchered669

Cultivated / captive5

Other264

Origin

Native198

Introduced7

Range

Area of Occupancy AOO17 036 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy98% within 1 km

≤100 m 8 141≤1 km 684≤10 km 137>10 km 38

9 000 georeferenced · 161 without coordinates

Open the mapobservation + sensor9 161

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy34% within 1 km

≤100 m 92≤1 km 99≤10 km 329>10 km 42

562 georeferenced · 107 without coordinates

Open the institutions mapphysical evidence669

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 3

3 georeferenced · 2 without coordinates

Open the mapnot free-living5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	205
Museo Entomologico de Leonlocation not on record	126
Canberra, AU	97
Brisbane, AU	82
John T. Waterhouse Herbariumlocation not on record	40
Armidale, AU	37
NSW Dept of Planning, Industry and Environmentlocation not on record	19
Batemans Bay, AU	14
Wollongong, AU	12
Adelaide, AU	10
Smithfield, AU	9
Hobart, AU	2
Paris, FR	1
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	1
Wellington, NZ	1
James Cook Townsvillelocation not on record	1
Kew, GB	1
Auckland, NZ	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
Saint Louis, US	1
University of Stellenboschlocation not on record	1
Cambridge University Herbariumlocation not on record	1
La Trobe Universitylocation not on record	1

23 institutions · 664 of 669 vouchered records shown · 5 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Notelaea longifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.7 °C 19.7–19.7

Seasonal swing summer↔winter10.3 °C

Max temp (day)24.1 °C

Min temp (night)15.9 °C

Precipitation120 mm/mo

Air humidity60.4 %

Moisture balance7.80 mm/mo

Vapour deficit913 Pa

Wind speed2.00 m/s

Cloud cover25.4 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Notelaea longifolia

At a glance

Sources10 archives

Size & morphology16

Life cycle & reproduction10

Diet & foraging1

Habitat & environment10

Physiology & chemistry6

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type10 099 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions14 of 23 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type10 099 records