Notelaea lloydii

Guymer · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Oleaceae/Notelaea

At a glance

Occurrence records209

Data sources6

Biological traits18

DNA specimens4

eDNA detections2

Sources6 archives

Databases and archives Notelaea lloydii's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility209 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources18 traits

Occurrence & distributionGBIF209 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Notelaea lloydii, commonly known as Lloyd's olive, is a shrub in the olive family, found in Queensland, Australia. It is listed as "vulnerable" under the Commonwealth Environment Protection and Biodiversity Conservation Act 1999. The species was formally described by Gordon Guymer in 1987, based on plant material collected in Ipswich.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFT

Size & morphology5

Leaf length105 mm

Leaf width6.5 mm

Plant height4 m

Seed length4.5 mm

Seed width3.5 mm

Life cycle & reproduction4

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment8

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typedrupe

Growth formshrub

Leaf compoundnesssimple

Woodinesswoody

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Notelaea lloydii has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes4

GenBank sequences3

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKM895729.1 ↗553 bpAustralia

ACGT

AAGTGTGGGATTCAAAGCGGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGAATACGAAACCAAAGATACTGATATCTTGGCAGC …

Notelaea lloydii voucher 1076420389 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL1★rbcLatrnH-psbA

plant barcodemarker

08Occurrence & distribution

Record type209 records

Wild obs. + sensor60

Museum / vouchered147

Other2

Origin

Native20

Range

Area of Occupancy AOO288 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy74% within 1 km

≤100 m 23≤1 km 9≤10 km 1>10 km 10

43 georeferenced · 17 without coordinates

Open the mapobservation + sensor60

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy66% within 1 km

≤100 m 81≤1 km 3≤10 km 44

128 georeferenced · 19 without coordinates

Open the institutions mapphysical evidence147

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	100
Mount Annan, AU	9
Canberra, AU	9
Adelaide, AU	6
Museo Entomologico de Leonlocation not on record	5
Armidale, AU	3
IPA/SPlocation not on record	2
Saint Louis, US	2
Palmerston, AU	2
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	1
NSW Dept of Planning, Industry and Environmentlocation not on record	1
Kew, GB	1
Smithfield, AU	1
University of Stellenboschlocation not on record	1

14 institutions · 143 of 147 vouchered records shown · 4 without an institution code

09Environmental DNA2 detections

Where the DNA of Notelaea lloydii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.6 °C 17.6–17.6

Seasonal swing summer↔winter12.1 °C

Max temp (day)23.1 °C

Min temp (night)12.6 °C

Precipitation65.1 mm/mo

Air humidity57.6 %

Moisture balance-54.9 mm/mo

Vapour deficit873 Pa

Wind speed3.90 m/s

Cloud cover23.4 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)